ID: 1069689759

View in Genome Browser
Species Human (GRCh38)
Location 10:70342563-70342585
Sequence TTCTGTGGATGAGGAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7938
Summary {0: 2, 1: 26, 2: 297, 3: 1507, 4: 6106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689759_1069689766 13 Left 1069689759 10:70342563-70342585 CCTCAGTTTCCTCATCCACAGAA 0: 2
1: 26
2: 297
3: 1507
4: 6106
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689759_1069689765 12 Left 1069689759 10:70342563-70342585 CCTCAGTTTCCTCATCCACAGAA 0: 2
1: 26
2: 297
3: 1507
4: 6106
Right 1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689759 Original CRISPR TTCTGTGGATGAGGAAACTG AGG (reversed) Intronic
Too many off-targets to display for this crispr