ID: 1069689760

View in Genome Browser
Species Human (GRCh38)
Location 10:70342569-70342591
Sequence TTTCCTCATCCACAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689757_1069689760 -10 Left 1069689757 10:70342556-70342578 CCCTGAGCCTCAGTTTCCTCATC 0: 60
1: 436
2: 1255
3: 2528
4: 4241
Right 1069689760 10:70342569-70342591 TTTCCTCATCCACAGAATGAAGG No data
1069689756_1069689760 17 Left 1069689756 10:70342529-70342551 CCAGTTCATCAAGGTGTCACTCA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1069689760 10:70342569-70342591 TTTCCTCATCCACAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689760 Original CRISPR TTTCCTCATCCACAGAATGA AGG Intronic
No off target data available for this crispr