ID: 1069689761

View in Genome Browser
Species Human (GRCh38)
Location 10:70342572-70342594
Sequence GTACCTTCATTCTGTGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689761_1069689765 3 Left 1069689761 10:70342572-70342594 CCTCATCCACAGAATGAAGGTAC No data
Right 1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG No data
1069689761_1069689766 4 Left 1069689761 10:70342572-70342594 CCTCATCCACAGAATGAAGGTAC No data
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689761 Original CRISPR GTACCTTCATTCTGTGGATG AGG (reversed) Intronic
No off target data available for this crispr