ID: 1069689762

View in Genome Browser
Species Human (GRCh38)
Location 10:70342578-70342600
Sequence CTGGTGGTACCTTCATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689762_1069689765 -3 Left 1069689762 10:70342578-70342600 CCACAGAATGAAGGTACCACCAG No data
Right 1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG No data
1069689762_1069689766 -2 Left 1069689762 10:70342578-70342600 CCACAGAATGAAGGTACCACCAG No data
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689762 Original CRISPR CTGGTGGTACCTTCATTCTG TGG (reversed) Intronic