ID: 1069689762

View in Genome Browser
Species Human (GRCh38)
Location 10:70342578-70342600
Sequence CTGGTGGTACCTTCATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689762_1069689766 -2 Left 1069689762 10:70342578-70342600 CCACAGAATGAAGGTACCACCAG 0: 1
1: 0
2: 0
3: 6
4: 150
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689762_1069689765 -3 Left 1069689762 10:70342578-70342600 CCACAGAATGAAGGTACCACCAG 0: 1
1: 0
2: 0
3: 6
4: 150
Right 1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689762 Original CRISPR CTGGTGGTACCTTCATTCTG TGG (reversed) Intronic
901184213 1:7361904-7361926 CTGGGGCTGCCTTCCTTCTGGGG + Intronic
902505260 1:16935755-16935777 ATGATGGTACATCCATTCTGTGG - Intronic
902931523 1:19734861-19734883 CTGGTGGAACCTCCCTCCTGTGG + Intronic
904299214 1:29543290-29543312 CTGGTGGTAGATTCCTGCTGTGG + Intergenic
905965667 1:42093259-42093281 CTGGTGGTTCTATGATTCTGGGG + Intergenic
911745045 1:101432613-101432635 CTAGTGTGACCTTCATTTTGTGG - Intergenic
915916506 1:159943901-159943923 CTGGGGATGCCTGCATTCTGAGG + Intronic
915966662 1:160314916-160314938 GTGGTGGTACCCTTATTTTGAGG - Intronic
918353088 1:183677898-183677920 CTGTTCAGACCTTCATTCTGAGG - Intronic
918960421 1:191268953-191268975 ATGGTGGTGCCTTGATTCTCAGG - Intergenic
924427959 1:243971024-243971046 CTGGTGGAACGTGCATTCTAAGG - Intergenic
1063282727 10:4648437-4648459 CAGGTGGTGTCTTCATCCTGAGG - Intergenic
1069106107 10:64385077-64385099 CTGGTGGTTCTACCATTCTGGGG + Intergenic
1069294481 10:66827088-66827110 CCTGTGCCACCTTCATTCTGAGG - Intronic
1069689762 10:70342578-70342600 CTGGTGGTACCTTCATTCTGTGG - Intronic
1070578800 10:77703083-77703105 CTGGTGCTGGCTTCATCCTGAGG - Intergenic
1074273586 10:111979355-111979377 CTGGTTATTCCTTCTTTCTGAGG - Intergenic
1075365353 10:121883274-121883296 CTTGTGGAACTTGCATTCTGGGG - Intronic
1077735161 11:4783121-4783143 CTGGTGGATCTATCATTCTGGGG - Intronic
1078045390 11:7909703-7909725 TTGGAGGGACCTTGATTCTGAGG - Intergenic
1078055927 11:8008868-8008890 CTTTTGGTGCCTTCATGCTGAGG - Intergenic
1079250402 11:18782935-18782957 CTGGTGTTTCCATCCTTCTGTGG - Intronic
1080030461 11:27655668-27655690 CTGATGGTATCTTCATTCCTGGG + Exonic
1080151493 11:29057080-29057102 TTGGTGGAACCACCATTCTGGGG - Intergenic
1083433785 11:62629196-62629218 CTGGTGGGACTTTCCTTCTGTGG - Exonic
1090875365 11:130784277-130784299 CTGGTGGGATCTTCACTATGGGG - Intergenic
1091211426 11:133864478-133864500 CTGCTGGCACCTTCAGGCTGTGG - Intergenic
1091637149 12:2205795-2205817 CTGCTGGCACCTTGATCCTGGGG - Intronic
1092115274 12:5996905-5996927 GTGGTGGTGCCTTCAATGTGAGG - Intronic
1093732091 12:22576626-22576648 CAGGTGGTGCCTTCTTGCTGTGG + Intergenic
1095247013 12:39935020-39935042 CTCTTGGTTCCTTCTTTCTGAGG - Intronic
1095979201 12:47961408-47961430 TTAGAGGTACCTTGATTCTGAGG + Intergenic
1098253232 12:68590317-68590339 CTGGTGGATCCACCATTCTGTGG - Intergenic
1102232555 12:111273640-111273662 CAAGTGGAACTTTCATTCTGGGG + Intronic
1102385712 12:112507729-112507751 CTGGTGGTAGTTCCTTTCTGAGG + Exonic
1102437992 12:112940143-112940165 AAAGTGGTACCTTCCTTCTGGGG + Intronic
1103957841 12:124588356-124588378 CTGGTGTTGGCTTCATTCTAGGG - Intergenic
1105771555 13:23617131-23617153 CTGGAGGTTCCTTCTGTCTGCGG - Intronic
1109404475 13:61878924-61878946 TTGGTGGATCCATCATTCTGGGG - Intergenic
1110045018 13:70816953-70816975 TAGGAGGTACCTTCATTCTCTGG + Intergenic
1113468946 13:110530819-110530841 CTGGTGGGACCTGCCTCCTGAGG - Intronic
1113545532 13:111146165-111146187 CTGGGGTGACCTTCATTCTGTGG + Intronic
1115522093 14:34243187-34243209 GTGCTGGTACCATCATGCTGTGG + Intronic
1116776227 14:49184213-49184235 CAGGTTGTCTCTTCATTCTGTGG - Intergenic
1116982253 14:51184045-51184067 TTGGTCATACCTTCTTTCTGGGG + Intergenic
1119659657 14:76441269-76441291 GTGGTGGCACCCTCTTTCTGTGG + Intronic
1119803308 14:77464485-77464507 CTGGTCATAACCTCATTCTGTGG + Intronic
1123140574 14:106073439-106073461 CTGGTGGTTCTACCATTCTGGGG - Intergenic
1127272529 15:57414209-57414231 CTGGTGGCCCCTTCATCCTTTGG + Intronic
1127412656 15:58724733-58724755 CTGGTGGTTCATTTTTTCTGAGG - Intronic
1133620555 16:7522035-7522057 GTGGTGTTATCTTCATTCAGTGG + Intronic
1135931786 16:26744255-26744277 CTGTTGGCACCATCATTTTGGGG - Intergenic
1144049508 17:11486534-11486556 CTGCTGGTTGCGTCATTCTGTGG - Intronic
1146624036 17:34422537-34422559 CTGGTGGTCTCTTCTTCCTGGGG - Intergenic
1149173788 17:53844996-53845018 CAGTTTGTACCTACATTCTGCGG + Intergenic
1151207971 17:72522298-72522320 CTGGAGGTTCCTGCTTTCTGAGG - Intergenic
1151889050 17:76941452-76941474 TGGCTGGTTCCTTCATTCTGGGG + Intronic
1160995969 19:1882001-1882023 GTGGGGGTTCCTTCATCCTGTGG - Intronic
1163117024 19:15195258-15195280 CTGTTGGTACCCTCATCTTGGGG + Intronic
1163189989 19:15670586-15670608 CTGGTGGTTCCATCCTTCTTAGG - Intergenic
1167437157 19:49486126-49486148 CTGGCGTTGCCTCCATTCTGGGG - Exonic
1168405359 19:56107738-56107760 CCTGTGGTGCCTTCTTTCTGAGG - Intronic
1168462678 19:56572585-56572607 CTGGTGGTACTTCAAATCTGGGG - Intronic
925103369 2:1268473-1268495 CTGGGTGTGACTTCATTCTGTGG - Intronic
925111446 2:1341728-1341750 CTGGAGGGACCTTGATTCCGAGG + Intronic
926049078 2:9731431-9731453 CTGGTGGTGGCTTTATGCTGGGG - Intergenic
926118102 2:10225883-10225905 CTGGTGGCTGCTTTATTCTGAGG + Intergenic
927016502 2:18968843-18968865 CTGTCGGTTCCTTCATTCTTTGG - Intergenic
932914635 2:75843438-75843460 CTGCTGGTGCCTTGATCCTGTGG - Intergenic
936328100 2:111522961-111522983 CTGGTGGTACCTTTAGTTTTTGG - Intergenic
941811110 2:169756865-169756887 CTGGTGGCTCTATCATTCTGGGG - Intronic
942138474 2:172953742-172953764 CTGGTGGTCCCAGCATTCGGTGG + Intronic
946272643 2:218607235-218607257 AAGGTGCTACCTCCATTCTGAGG + Intergenic
947334041 2:229062247-229062269 GTGGAGGTACATTCCTTCTGTGG + Intronic
1169296074 20:4400683-4400705 CTGTTGGTACCTTCATAGAGTGG + Intergenic
1169314547 20:4578025-4578047 ATAATGTTACCTTCATTCTGAGG - Intergenic
1169915244 20:10676340-10676362 CTGGTGGCACCTGCAATCTCAGG - Intergenic
1173052175 20:39574077-39574099 CTAGTGTTCCCTTCATTCTCTGG - Intergenic
1175100209 20:56574015-56574037 CTGCAGTTACCCTCATTCTGCGG - Intergenic
1175596575 20:60239401-60239423 CTGGTGGTGCTTTGATTCAGTGG + Intergenic
1176360147 21:5988356-5988378 CTGGTGGAGCCTTCTTTCTAAGG + Intergenic
1177489013 21:21797265-21797287 CTGGTGGTTTCCTCATTCTTGGG - Intergenic
1178011465 21:28291277-28291299 ATGGTGGAGCCTTCAGTCTGTGG + Intergenic
1178041012 21:28641163-28641185 TTGCTGGTACCTTCTATCTGTGG - Intergenic
1179763371 21:43550194-43550216 CTGGTGGAGCCTTCTTTCTAAGG - Intronic
1179994655 21:44968287-44968309 GTGGTGGTATCTTCATTGGGTGG - Intronic
950640824 3:14347022-14347044 CTGGCTGTACCTTCATTCCCTGG - Intergenic
953765073 3:45733789-45733811 CTGCTGTTACCTCCATTTTGTGG + Intronic
954647077 3:52138111-52138133 GTGGTGGTACCTTCACTGTCTGG - Intronic
955609906 3:60745865-60745887 GTGGTGGTACCTTGCTGCTGGGG - Intronic
957760307 3:84547879-84547901 CTGGTGTTCCCTTAATTGTGGGG + Intergenic
957939102 3:86982541-86982563 CTGGTGTTACATTCTTTCTTGGG + Intronic
959096701 3:101964315-101964337 CTGTTGGTTACTTCATCCTGTGG + Intergenic
959894998 3:111595392-111595414 CTGGAGGTGCCCTCCTTCTGGGG - Exonic
962119253 3:132544632-132544654 CTTCTGAGACCTTCATTCTGGGG + Intergenic
964872516 3:161328998-161329020 CATTTGTTACCTTCATTCTGTGG + Intergenic
965869896 3:173252859-173252881 CTGGTGGAGCCACCATTCTGGGG + Intergenic
966661360 3:182418371-182418393 CAGGTGGTACCTGCATATTGTGG - Intergenic
969704439 4:8784292-8784314 CTGGTGCTTCCTTCATCCAGGGG - Intergenic
970104062 4:12560256-12560278 CTTCTGGTGCCTGCATTCTGAGG + Intergenic
972133696 4:35865257-35865279 CTGGTGGCTCTATCATTCTGGGG - Intergenic
973808462 4:54547796-54547818 CTGGTGGCAGCTTCCTGCTGAGG + Intergenic
977213634 4:94251750-94251772 ATGGTGTTACCTTCATTCACAGG + Intronic
979568528 4:122185374-122185396 ATTGTGGTACCTTTCTTCTGTGG + Intronic
980183070 4:129426000-129426022 ATGGTGATAACTTCTTTCTGAGG - Intergenic
981263777 4:142756061-142756083 CTAGTGGTTGCTTTATTCTGGGG + Intronic
981527355 4:145720086-145720108 CTGTTGCCACCTTCATTCTGGGG - Intronic
988768055 5:34403296-34403318 GTGGTGGATCCATCATTCTGGGG + Intergenic
990199287 5:53353255-53353277 CTGGTGGTACTTTGATCTTGGGG - Intergenic
991514213 5:67415871-67415893 CTTCTGATACCATCATTCTGGGG + Intergenic
993230708 5:85231622-85231644 TTAGTGGTACTTTCATTGTGGGG + Intergenic
996159462 5:120145118-120145140 TTGGTGGATCCATCATTCTGGGG + Intergenic
996926756 5:128836038-128836060 TTGGTGGTGGCTTCATTCTCAGG - Intronic
1002170537 5:177371839-177371861 CTGGGGGGACCCTCATGCTGTGG + Intronic
1005112613 6:22299940-22299962 TTTGTGATACATTCATTCTGAGG - Intergenic
1013308288 6:108870370-108870392 TGAGTGGTACCTCCATTCTGTGG + Intronic
1014965772 6:127748313-127748335 CTGGTGATGGCTTCATGCTGTGG + Intronic
1015901789 6:138075269-138075291 CTGGTGGTTCTACCATTCTGGGG - Intergenic
1020397022 7:7728064-7728086 CTCTTGGGACCTCCATTCTGTGG + Intronic
1021542686 7:21777289-21777311 ATTGTGCTACCTTCATTCTGTGG - Intronic
1021961265 7:25875374-25875396 CTGCTGACTCCTTCATTCTGGGG - Intergenic
1024166436 7:46737141-46737163 GTGGTGGTACATTCATTCCCTGG + Intronic
1024858563 7:53811608-53811630 CTGTTGGTTCCGTCCTTCTGCGG - Intergenic
1032846651 7:135757117-135757139 CTCCTAGTAACTTCATTCTGGGG - Intergenic
1034445716 7:151113263-151113285 CTGCTGGTACTTCCATTGTGGGG + Intronic
1036444151 8:8807117-8807139 TTAGAGGGACCTTCATTCTGAGG - Intronic
1036462378 8:8964784-8964806 TTAGAGGGACCTTCATTCTGAGG + Intergenic
1036627355 8:10483145-10483167 CTGGTGGTACCTGCTGTATGGGG + Intergenic
1038107754 8:24454899-24454921 CAGATTGTACATTCATTCTGTGG + Intronic
1039824335 8:41160343-41160365 CTGGTGGTGCTTACAGTCTGTGG + Intergenic
1040447599 8:47511484-47511506 CTGCTGGCACCTCCCTTCTGTGG + Intronic
1041859581 8:62497749-62497771 CAGTTGGTACCTTGACTCTGAGG + Intronic
1042734438 8:71971781-71971803 GTGGTAATACATTCATTCTGTGG - Intronic
1043020416 8:74992800-74992822 CTGGTGGTACTTTCAGTCCTGGG + Intronic
1043940409 8:86190015-86190037 CTGGTGGATCTATCATTCTGGGG + Intergenic
1048874082 8:138822897-138822919 CAGGTGGTAGCTTCCTCCTGTGG + Intronic
1051201757 9:14633952-14633974 CTGGTGGTACATTCACCCAGTGG - Intronic
1051821288 9:21172387-21172409 CTGCTGGTACCTTGATTCTTGGG + Intergenic
1052251374 9:26401710-26401732 CTGGTGGAATCTACATTCTATGG + Intergenic
1052790298 9:32869412-32869434 CAGGTGGCTCCTTCATCCTGTGG - Intergenic
1052895363 9:33742638-33742660 CTGGTGGTAGGTTGATTATGTGG - Intergenic
1055519366 9:77064932-77064954 CTGCTGAGACCTTCATTTTGGGG - Intergenic
1056474624 9:86941861-86941883 CTGGTGGTCCCTTAAATTTGTGG + Intergenic
1057986299 9:99718003-99718025 ATGGTGGTACCTTGATTATTTGG - Intergenic
1058109233 9:101013449-101013471 ATGGTAGTTCCTTCATACTGTGG - Intergenic
1187226532 X:17378798-17378820 CAGGTGCTACCTTCCATCTGTGG - Intronic
1188612476 X:32117410-32117432 CTGCTGGGACCTGGATTCTGTGG - Intronic
1192630042 X:72770112-72770134 CTGGAGGTTCCTTTATTATGTGG - Intergenic
1192651668 X:72950692-72950714 CTGGAGGTTCCTTTATTATGTGG + Intergenic
1194082870 X:89489972-89489994 TTGGTGGATCCATCATTCTGGGG + Intergenic
1194969249 X:100324879-100324901 CTGGTAGTACCTGCCTTGTGGGG - Intronic
1195416778 X:104628933-104628955 GTGGTGGTACATTCATACTATGG + Intronic
1196631176 X:117941644-117941666 CTGATGGTAGTTTCTTTCTGTGG + Intronic
1197368824 X:125600720-125600742 TTGGTGGAACTATCATTCTGGGG - Intergenic
1197439942 X:126475834-126475856 TTGGTGGAACTATCATTCTGGGG + Intergenic
1197986249 X:132269258-132269280 CTTGTGGTACTTACAGTCTGAGG - Intergenic
1198052423 X:132961741-132961763 CTGGTTCTACCTGCATTCTGTGG + Intergenic