ID: 1069689766

View in Genome Browser
Species Human (GRCh38)
Location 10:70342599-70342621
Sequence AGCTGCCTAGCAGAGCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069689757_1069689766 20 Left 1069689757 10:70342556-70342578 CCCTGAGCCTCAGTTTCCTCATC 0: 60
1: 436
2: 1255
3: 2528
4: 4241
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689758_1069689766 19 Left 1069689758 10:70342557-70342579 CCTGAGCCTCAGTTTCCTCATCC 0: 7
1: 123
2: 745
3: 1942
4: 3908
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689761_1069689766 4 Left 1069689761 10:70342572-70342594 CCTCATCCACAGAATGAAGGTAC No data
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689759_1069689766 13 Left 1069689759 10:70342563-70342585 CCTCAGTTTCCTCATCCACAGAA 0: 2
1: 26
2: 297
3: 1507
4: 6106
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data
1069689762_1069689766 -2 Left 1069689762 10:70342578-70342600 CCACAGAATGAAGGTACCACCAG 0: 1
1: 0
2: 0
3: 6
4: 150
Right 1069689766 10:70342599-70342621 AGCTGCCTAGCAGAGCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069689766 Original CRISPR AGCTGCCTAGCAGAGCTGTT GGG Intronic
No off target data available for this crispr