ID: 1069691467

View in Genome Browser
Species Human (GRCh38)
Location 10:70355817-70355839
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069691467_1069691476 19 Left 1069691467 10:70355817-70355839 CCTGCCAGGGCAAAGCTCACGGG No data
Right 1069691476 10:70355859-70355881 CGCACGCTCAGAGGGCTGTGTGG No data
1069691467_1069691473 10 Left 1069691467 10:70355817-70355839 CCTGCCAGGGCAAAGCTCACGGG No data
Right 1069691473 10:70355850-70355872 GAGAGCAGCCGCACGCTCAGAGG No data
1069691467_1069691474 11 Left 1069691467 10:70355817-70355839 CCTGCCAGGGCAAAGCTCACGGG No data
Right 1069691474 10:70355851-70355873 AGAGCAGCCGCACGCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069691467 Original CRISPR CCCGTGAGCTTTGCCCTGGC AGG (reversed) Intronic