ID: 1069691473

View in Genome Browser
Species Human (GRCh38)
Location 10:70355850-70355872
Sequence GAGAGCAGCCGCACGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069691467_1069691473 10 Left 1069691467 10:70355817-70355839 CCTGCCAGGGCAAAGCTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1069691473 10:70355850-70355872 GAGAGCAGCCGCACGCTCAGAGG No data
1069691469_1069691473 6 Left 1069691469 10:70355821-70355843 CCAGGGCAAAGCTCACGGGAGCT 0: 1
1: 1
2: 0
3: 10
4: 115
Right 1069691473 10:70355850-70355872 GAGAGCAGCCGCACGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069691473 Original CRISPR GAGAGCAGCCGCACGCTCAG AGG Intronic
No off target data available for this crispr