ID: 1069691474 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:70355851-70355873 |
Sequence | AGAGCAGCCGCACGCTCAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1069691469_1069691474 | 7 | Left | 1069691469 | 10:70355821-70355843 | CCAGGGCAAAGCTCACGGGAGCT | No data | ||
Right | 1069691474 | 10:70355851-70355873 | AGAGCAGCCGCACGCTCAGAGGG | No data | ||||
1069691467_1069691474 | 11 | Left | 1069691467 | 10:70355817-70355839 | CCTGCCAGGGCAAAGCTCACGGG | No data | ||
Right | 1069691474 | 10:70355851-70355873 | AGAGCAGCCGCACGCTCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1069691474 | Original CRISPR | AGAGCAGCCGCACGCTCAGA GGG | Intronic | ||