ID: 1069691480

View in Genome Browser
Species Human (GRCh38)
Location 10:70355903-70355925
Sequence ACACGAATCCTGCATCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069691475_1069691480 22 Left 1069691475 10:70355858-70355880 CCGCACGCTCAGAGGGCTGTGTG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1069691480 10:70355903-70355925 ACACGAATCCTGCATCTCAGAGG No data
1069691478_1069691480 -6 Left 1069691478 10:70355886-70355908 CCCTCTGACAAACGCACACACGA 0: 1
1: 0
2: 1
3: 9
4: 153
Right 1069691480 10:70355903-70355925 ACACGAATCCTGCATCTCAGAGG No data
1069691479_1069691480 -7 Left 1069691479 10:70355887-70355909 CCTCTGACAAACGCACACACGAA 0: 1
1: 0
2: 0
3: 12
4: 242
Right 1069691480 10:70355903-70355925 ACACGAATCCTGCATCTCAGAGG No data
1069691477_1069691480 -5 Left 1069691477 10:70355885-70355907 CCCCTCTGACAAACGCACACACG 0: 1
1: 0
2: 1
3: 28
4: 244
Right 1069691480 10:70355903-70355925 ACACGAATCCTGCATCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069691480 Original CRISPR ACACGAATCCTGCATCTCAG AGG Intronic
No off target data available for this crispr