ID: 1069693753

View in Genome Browser
Species Human (GRCh38)
Location 10:70371956-70371978
Sequence CAGGGTTACTTGGCTGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069693747_1069693753 12 Left 1069693747 10:70371921-70371943 CCCAGGAGCACTGGGGGAGCATG 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1069693753 10:70371956-70371978 CAGGGTTACTTGGCTGAGTAAGG No data
1069693748_1069693753 11 Left 1069693748 10:70371922-70371944 CCAGGAGCACTGGGGGAGCATGT 0: 1
1: 0
2: 2
3: 40
4: 232
Right 1069693753 10:70371956-70371978 CAGGGTTACTTGGCTGAGTAAGG No data
1069693746_1069693753 13 Left 1069693746 10:70371920-70371942 CCCCAGGAGCACTGGGGGAGCAT No data
Right 1069693753 10:70371956-70371978 CAGGGTTACTTGGCTGAGTAAGG No data
1069693741_1069693753 22 Left 1069693741 10:70371911-70371933 CCAGGGGTGCCCCAGGAGCACTG 0: 1
1: 0
2: 5
3: 49
4: 352
Right 1069693753 10:70371956-70371978 CAGGGTTACTTGGCTGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069693753 Original CRISPR CAGGGTTACTTGGCTGAGTA AGG Intronic
No off target data available for this crispr