ID: 1069694661

View in Genome Browser
Species Human (GRCh38)
Location 10:70377670-70377692
Sequence AAGGGCAGAGAGAAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069694653_1069694661 3 Left 1069694653 10:70377644-70377666 CCAAGGGCCAAAGGCAGAAGAAG 0: 1
1: 0
2: 4
3: 55
4: 437
Right 1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG No data
1069694655_1069694661 -4 Left 1069694655 10:70377651-70377673 CCAAAGGCAGAAGAAGGCGAAGG 0: 1
1: 0
2: 0
3: 20
4: 274
Right 1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG No data
1069694651_1069694661 17 Left 1069694651 10:70377630-70377652 CCAGTGAACTCACTCCAAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069694661 Original CRISPR AAGGGCAGAGAGAAGGGGCA TGG Intronic
No off target data available for this crispr