ID: 1069698436

View in Genome Browser
Species Human (GRCh38)
Location 10:70404640-70404662
Sequence CCCCGGGGCTTCGGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069698436_1069698441 -9 Left 1069698436 10:70404640-70404662 CCAGCTCCACCGAAGCCCCGGGG 0: 1
1: 1
2: 0
3: 17
4: 173
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698436_1069698440 -10 Left 1069698436 10:70404640-70404662 CCAGCTCCACCGAAGCCCCGGGG 0: 1
1: 1
2: 0
3: 17
4: 173
Right 1069698440 10:70404653-70404675 AGCCCCGGGGACGCTGCCCTTGG 0: 1
1: 0
2: 0
3: 19
4: 211
1069698436_1069698448 9 Left 1069698436 10:70404640-70404662 CCAGCTCCACCGAAGCCCCGGGG 0: 1
1: 1
2: 0
3: 17
4: 173
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698436_1069698447 8 Left 1069698436 10:70404640-70404662 CCAGCTCCACCGAAGCCCCGGGG 0: 1
1: 1
2: 0
3: 17
4: 173
Right 1069698447 10:70404671-70404693 CTTGGGCCCGCCCGAGCGTTCGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069698436 Original CRISPR CCCCGGGGCTTCGGTGGAGC TGG (reversed) Intronic