ID: 1069698441

View in Genome Browser
Species Human (GRCh38)
Location 10:70404654-70404676
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069698430_1069698441 -3 Left 1069698430 10:70404634-70404656 CCGCCCCCAGCTCCACCGAAGCC 0: 1
1: 0
2: 6
3: 56
4: 771
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698423_1069698441 21 Left 1069698423 10:70404610-70404632 CCTCGGTGCCCGGCCGCTTCGCC 0: 1
1: 0
2: 3
3: 34
4: 612
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698426_1069698441 8 Left 1069698426 10:70404623-70404645 CCGCTTCGCCCCCGCCCCCAGCT 0: 1
1: 1
2: 8
3: 83
4: 838
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698428_1069698441 -1 Left 1069698428 10:70404632-70404654 CCCCGCCCCCAGCTCCACCGAAG 0: 1
1: 0
2: 2
3: 21
4: 283
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698436_1069698441 -9 Left 1069698436 10:70404640-70404662 CCAGCTCCACCGAAGCCCCGGGG 0: 1
1: 1
2: 0
3: 17
4: 173
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698429_1069698441 -2 Left 1069698429 10:70404633-70404655 CCCGCCCCCAGCTCCACCGAAGC 0: 1
1: 0
2: 1
3: 43
4: 400
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698427_1069698441 0 Left 1069698427 10:70404631-70404653 CCCCCGCCCCCAGCTCCACCGAA 0: 1
1: 0
2: 0
3: 48
4: 576
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698434_1069698441 -8 Left 1069698434 10:70404639-70404661 CCCAGCTCCACCGAAGCCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698424_1069698441 13 Left 1069698424 10:70404618-70404640 CCCGGCCGCTTCGCCCCCGCCCC 0: 1
1: 1
2: 7
3: 79
4: 667
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698431_1069698441 -6 Left 1069698431 10:70404637-70404659 CCCCCAGCTCCACCGAAGCCCCG 0: 1
1: 0
2: 3
3: 22
4: 325
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698425_1069698441 12 Left 1069698425 10:70404619-70404641 CCGGCCGCTTCGCCCCCGCCCCC 0: 1
1: 0
2: 10
3: 120
4: 1102
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698422_1069698441 29 Left 1069698422 10:70404602-70404624 CCTCGGCGCCTCGGTGCCCGGCC 0: 1
1: 0
2: 2
3: 29
4: 260
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140
1069698432_1069698441 -7 Left 1069698432 10:70404638-70404660 CCCCAGCTCCACCGAAGCCCCGG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1069698441 10:70404654-70404676 GCCCCGGGGACGCTGCCCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type