ID: 1069698448

View in Genome Browser
Species Human (GRCh38)
Location 10:70404672-70404694
Sequence TTGGGCCCGCCCGAGCGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069698432_1069698448 11 Left 1069698432 10:70404638-70404660 CCCCAGCTCCACCGAAGCCCCGG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698425_1069698448 30 Left 1069698425 10:70404619-70404641 CCGGCCGCTTCGCCCCCGCCCCC 0: 1
1: 0
2: 10
3: 120
4: 1102
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698438_1069698448 3 Left 1069698438 10:70404646-70404668 CCACCGAAGCCCCGGGGACGCTG 0: 1
1: 0
2: 0
3: 18
4: 129
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698443_1069698448 -7 Left 1069698443 10:70404656-70404678 CCCGGGGACGCTGCCCTTGGGCC 0: 1
1: 0
2: 1
3: 16
4: 264
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698430_1069698448 15 Left 1069698430 10:70404634-70404656 CCGCCCCCAGCTCCACCGAAGCC 0: 1
1: 0
2: 6
3: 56
4: 771
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698431_1069698448 12 Left 1069698431 10:70404637-70404659 CCCCCAGCTCCACCGAAGCCCCG 0: 1
1: 0
2: 3
3: 22
4: 325
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698429_1069698448 16 Left 1069698429 10:70404633-70404655 CCCGCCCCCAGCTCCACCGAAGC 0: 1
1: 0
2: 1
3: 43
4: 400
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698426_1069698448 26 Left 1069698426 10:70404623-70404645 CCGCTTCGCCCCCGCCCCCAGCT 0: 1
1: 1
2: 8
3: 83
4: 838
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698442_1069698448 -6 Left 1069698442 10:70404655-70404677 CCCCGGGGACGCTGCCCTTGGGC 0: 1
1: 0
2: 2
3: 12
4: 174
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698428_1069698448 17 Left 1069698428 10:70404632-70404654 CCCCGCCCCCAGCTCCACCGAAG 0: 1
1: 0
2: 2
3: 21
4: 283
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698436_1069698448 9 Left 1069698436 10:70404640-70404662 CCAGCTCCACCGAAGCCCCGGGG 0: 1
1: 1
2: 0
3: 17
4: 173
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698444_1069698448 -8 Left 1069698444 10:70404657-70404679 CCGGGGACGCTGCCCTTGGGCCC 0: 1
1: 0
2: 1
3: 28
4: 224
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698427_1069698448 18 Left 1069698427 10:70404631-70404653 CCCCCGCCCCCAGCTCCACCGAA 0: 1
1: 0
2: 0
3: 48
4: 576
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698434_1069698448 10 Left 1069698434 10:70404639-70404661 CCCAGCTCCACCGAAGCCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1069698439_1069698448 0 Left 1069698439 10:70404649-70404671 CCGAAGCCCCGGGGACGCTGCCC 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1069698448 10:70404672-70404694 TTGGGCCCGCCCGAGCGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069698448 Original CRISPR TTGGGCCCGCCCGAGCGTTC GGG Intronic