ID: 1069702205

View in Genome Browser
Species Human (GRCh38)
Location 10:70435122-70435144
Sequence CTCGGTCATCTCTACATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069702198_1069702205 20 Left 1069702198 10:70435079-70435101 CCAGTGACGCATGACCCCATACA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 80
1069702201_1069702205 6 Left 1069702201 10:70435093-70435115 CCCCATACAGGCTCTATAAGGAT 0: 1
1: 0
2: 2
3: 8
4: 101
Right 1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 80
1069702197_1069702205 21 Left 1069702197 10:70435078-70435100 CCCAGTGACGCATGACCCCATAC 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 80
1069702203_1069702205 4 Left 1069702203 10:70435095-70435117 CCATACAGGCTCTATAAGGATGT 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 80
1069702202_1069702205 5 Left 1069702202 10:70435094-70435116 CCCATACAGGCTCTATAAGGATG 0: 1
1: 0
2: 0
3: 1
4: 71
Right 1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069702205 Original CRISPR CTCGGTCATCTCTACATGCC TGG Intronic
902143578 1:14377737-14377759 GTAGGTCATCACTATATGCCTGG - Intergenic
906585070 1:46968478-46968500 CTCAGCCATCTCTACATGTATGG - Intergenic
907058219 1:51392229-51392251 CTGTTTCATCTCTCCATGCCTGG + Intronic
909588398 1:77317562-77317584 CTTGCTCATCTTTTCATGCCAGG + Intronic
911161558 1:94686978-94687000 CTCTGTCTTCCCAACATGCCAGG + Intergenic
912736440 1:112153254-112153276 CTAGAGCAGCTCTACATGCCCGG - Intergenic
918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG + Intergenic
923050020 1:230384443-230384465 CTCGTTCAGCTTCACATGCCAGG - Intronic
924001725 1:239561079-239561101 CTGGTTCATCTCAACTTGCCTGG + Intronic
1063547439 10:6995928-6995950 CTCATTCATTTCTACATTCCTGG + Intergenic
1068886656 10:62104815-62104837 CTTGGTCATCTATACGTGCCAGG + Intergenic
1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG + Intronic
1069784804 10:70981204-70981226 TTGGGTCATCTCTGCCTGCCCGG + Intergenic
1072736092 10:97880628-97880650 CTAGGTGATCTCTTCATGCATGG + Intronic
1076616774 10:131760138-131760160 CCCAAGCATCTCTACATGCCAGG - Intergenic
1083298771 11:61729251-61729273 CTCTGTCATCTCAAGAGGCCAGG - Intronic
1085155029 11:74285756-74285778 CTCTTTCATCTTCACATGCCTGG - Intronic
1089063048 11:115641944-115641966 CTCTTTGATCTCTACATCCCTGG - Intergenic
1090422398 11:126584516-126584538 CTCGGTCATACCCACATGCCTGG - Intronic
1091261109 11:134234954-134234976 CTGGGTGATCTCTCCAGGCCGGG - Exonic
1092165247 12:6338353-6338375 CTCGGTCCTCTCCGCATTCCTGG + Intronic
1102203791 12:111076363-111076385 CTAGGTCATCTCTACATGGTAGG - Intronic
1107981532 13:45738549-45738571 GTCAGTCATCCCTACATCCCTGG - Intergenic
1113890917 13:113735221-113735243 CTCGATCATCTCCTCCTGCCAGG - Exonic
1114164716 14:20209245-20209267 TTCTGTCATCTCTACAGCCCTGG + Intergenic
1114829092 14:26117344-26117366 CCAGCACATCTCTACATGCCTGG - Intergenic
1122358034 14:101135990-101136012 CTCTGTCATCCAGACATGCCTGG - Intergenic
1122488372 14:102096452-102096474 CCCGATCATCTCTTCATGCTGGG + Intronic
1128551596 15:68601249-68601271 CTCAACCATCTCTACATCCCAGG - Intronic
1129419708 15:75414720-75414742 CCCGGTAATCACTCCATGCCTGG + Intronic
1130563678 15:84977806-84977828 CTCGGTCATCTCCAGATTCATGG - Intergenic
1143027121 17:3947528-3947550 GGCTGTCATCACTACATGCCTGG - Exonic
1143500805 17:7337375-7337397 CTGGGTCACCTCTCCATGTCAGG - Intronic
1147159171 17:38560627-38560649 CACGCTGATCTCTCCATGCCTGG + Intronic
1147439637 17:40440115-40440137 CTTGGTCATCTCTGCATCCCTGG + Intergenic
1148988878 17:51648025-51648047 CTGGGCCATCTTTACATCCCTGG + Intronic
1153599318 18:6763444-6763466 TTGGGTCATCTGTACATGTCTGG - Intronic
1155184267 18:23373439-23373461 ATCTGTCCTCTGTACATGCCTGG - Intronic
1155327420 18:24678959-24678981 CTCTGTCTCCTCTACCTGCCAGG + Intergenic
1162721485 19:12665460-12665482 CTCGGTCATCTCTGCCTTGCTGG - Exonic
1163143519 19:15365525-15365547 CTCTGCCAACTCCACATGCCTGG + Intronic
1165230327 19:34382725-34382747 CTAACTCATCTCTACATGCTGGG - Intronic
925341627 2:3141964-3141986 CTCAGTCACCTCTGCATCCCTGG + Intergenic
928898418 2:36292147-36292169 CTGAGTTATATCTACATGCCTGG + Intergenic
930917973 2:56717369-56717391 CTCGTTCATTTCTTCATACCAGG + Intergenic
932832449 2:75004133-75004155 CTTGGTCATCTCAAGTTGCCTGG - Intergenic
937473089 2:122190356-122190378 CAGGGTGATCTCTGCATGCCTGG + Intergenic
944898775 2:204193418-204193440 CATGGTCATCTCCACATGTCTGG - Intergenic
1169894427 20:10487698-10487720 CTCGAGCATCTCAGCATGCCTGG - Intronic
1171415935 20:24980432-24980454 CTCGGTCACCTCAACACGCCGGG + Intronic
1171415948 20:24980493-24980515 CTCGGTCACCTCTACACGCTGGG + Intronic
1171415964 20:24980586-24980608 CTCGGTCACCTCTACGCGCCGGG + Intronic
1171415992 20:24980772-24980794 CTCGGTCACTTCTACACACCGGG + Intronic
1171416005 20:24980863-24980885 CTCCATCACCTCTACACGCCAGG + Intronic
1175733848 20:61371935-61371957 CTGGGTCATCTCCACAAGACTGG - Intronic
1176148966 20:63579195-63579217 CTCTGTCCTCTCTCCCTGCCTGG + Intergenic
1177035018 21:16032212-16032234 CTGGATCTTCTCTACATGTCTGG - Intergenic
1182648488 22:31830076-31830098 CTCCGTCATTTCTCCAGGCCAGG + Intronic
949934119 3:9103291-9103313 CTAGCTCATCTCTTCTTGCCAGG - Intronic
951665843 3:25122731-25122753 CTCCGTCTTCTGTACATGCCTGG - Intergenic
956672086 3:71700638-71700660 CCCTGTCTTCTCTACAAGCCTGG + Intronic
960801228 3:121542469-121542491 CTGTGTCATCTGAACATGCCAGG - Intronic
963896280 3:150688443-150688465 CACGGACATCTCTCCATGTCAGG - Intronic
965125886 3:164628225-164628247 CTCTGTAATCTCTGCCTGCCAGG - Intergenic
966943803 3:184763474-184763496 CTCGGTCCTCTCCTCTTGCCTGG - Intergenic
968808231 4:2788530-2788552 CTGGGCCATCTCTGCATCCCAGG - Intergenic
970867265 4:20773425-20773447 CTCTGTCTCCTCTCCATGCCAGG + Intronic
984619382 4:181935642-181935664 ATGGCTCATCTCTGCATGCCGGG + Intergenic
992302761 5:75401133-75401155 CTCTGTCATATCAACATGCCTGG + Intronic
993416900 5:87645436-87645458 CTTAGTCATCTCTAAGTGCCTGG - Intergenic
993504789 5:88695425-88695447 CTCAGTCCTCTCTCCATCCCGGG - Intergenic
996223485 5:120961194-120961216 CTCCTGCATCTCTACATCCCTGG - Intergenic
996577517 5:124992334-124992356 CTCCCTCTTCTCTACTTGCCTGG + Intergenic
997675346 5:135708584-135708606 CTGGGTCATCTCTGCCTGACCGG - Intergenic
1006518086 6:34555706-34555728 CTGGGCCAACTCTACATGCTGGG - Intronic
1009297423 6:61970531-61970553 CTCAGTAATCTCTAAATGCTAGG - Intronic
1012799818 6:103811389-103811411 CTTGGTCATATCTACTTGCAAGG - Intergenic
1016806609 6:148218360-148218382 CTCTGTCATCTTTACATGTTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1029863273 7:103598487-103598509 CTGGCTCATTTCCACATGCCAGG - Intronic
1030855819 7:114555949-114555971 CTCCCTCATCTCTACCTGTCAGG + Intronic
1034897897 7:154889258-154889280 CTTGGTCATCTGCACATGCGGGG - Exonic
1035855167 8:2966651-2966673 CTCGGTCATCTATGCCTGCTGGG - Exonic
1037040306 8:14222885-14222907 CACTGTAACCTCTACATGCCGGG + Intronic
1043528780 8:81126872-81126894 ATTGGTCATCCCTACATCCCAGG + Intergenic
1047517130 8:125564690-125564712 CTCACTCATCTCTATATCCCTGG + Intergenic
1052833368 9:33233268-33233290 CTCCTTCACCTCTACATTCCAGG - Intronic
1061185921 9:129053242-129053264 CTGTGGCATATCTACATGCCAGG + Intronic
1196178034 X:112661589-112661611 CCAGGTCACCTCTTCATGCCAGG - Intronic