ID: 1069703152

View in Genome Browser
Species Human (GRCh38)
Location 10:70440802-70440824
Sequence TCGCGAACTGTGGCAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069703152_1069703157 6 Left 1069703152 10:70440802-70440824 CCCAAGGCTGCCACAGTTCGCGA 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1069703157 10:70440831-70440853 GACAGCCCATCCCTGATCTCCGG No data
1069703152_1069703158 7 Left 1069703152 10:70440802-70440824 CCCAAGGCTGCCACAGTTCGCGA 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1069703158 10:70440832-70440854 ACAGCCCATCCCTGATCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069703152 Original CRISPR TCGCGAACTGTGGCAGCCTT GGG (reversed) Intronic
901826114 1:11862629-11862651 TCACTCACTGTGGCAGCCTGGGG - Intergenic
902213982 1:14923489-14923511 TCTCCAACTATGGCAGCCATTGG - Intronic
905282328 1:36857173-36857195 TCGGGAAATTTGGGAGCCTTAGG - Intronic
905322965 1:37130754-37130776 ATGGGAACTGTGGCAGCATTGGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907723129 1:56992443-56992465 CCGGGAACTGTGACAGCCTCTGG + Intergenic
909774014 1:79461924-79461946 TTGCTAAATCTGGCAGCCTTAGG - Intergenic
911807641 1:102232033-102232055 TTGCGAAATCTGTCAGCCTTAGG - Intergenic
915002268 1:152604206-152604228 TGGGGAACTCTGGGAGCCTTTGG - Intergenic
916061717 1:161103288-161103310 TCAAGAACTGGGGCAGCTTTAGG - Intronic
917012050 1:170485721-170485743 TTGTGAATTGTGTCAGCCTTGGG - Intergenic
920530276 1:206696840-206696862 TCAGGGACTGTGGCAGCCCTGGG + Intronic
920956566 1:210625035-210625057 GCCTAAACTGTGGCAGCCTTGGG + Intronic
1067168318 10:43883074-43883096 CCTCGAACTGTGTCAACCTTGGG + Intergenic
1069703152 10:70440802-70440824 TCGCGAACTGTGGCAGCCTTGGG - Intronic
1073417439 10:103396185-103396207 TCGGAAACTGTGGGAGCCCTTGG + Intronic
1085049230 11:73371447-73371469 TCACGCACTGTGGCAGGCCTGGG - Intergenic
1089474581 11:118748287-118748309 TCATGAACTGTGACAACCTTTGG + Exonic
1091117556 11:133028285-133028307 TCAGGCACTGTGGCAGCCTGGGG + Intronic
1106795748 13:33203153-33203175 TCTCGAAATATGGCAGCCTTGGG - Intronic
1117980837 14:61340541-61340563 TCTGGAACTGGGGCAGGCTTAGG + Intronic
1126786997 15:52185503-52185525 GCGGGAACAGTGGCTGCCTTGGG + Intronic
1132738009 16:1397049-1397071 TCCCGACCTGTGCCAGCCCTCGG + Intronic
1152503493 17:80729864-80729886 GCGGGAACTGAGGCAGCCATGGG + Intronic
1153998612 18:10463895-10463917 TGGGGAGCTGTGCCAGCCTTGGG + Intronic
1156571218 18:38255569-38255591 GCGCTAACTGAGGCAGGCTTGGG + Intergenic
1161613460 19:5256987-5257009 GCGCTAACTGGGGCAGCCCTAGG + Intronic
1163798825 19:19352947-19352969 TCCAGAAAGGTGGCAGCCTTGGG + Intronic
928688247 2:33772500-33772522 TAGCGAAATCTGGCAACCTTAGG + Intergenic
934892698 2:98084686-98084708 TCGCCATCAGGGGCAGCCTTGGG - Intergenic
936482472 2:112897658-112897680 GCGAGAGCCGTGGCAGCCTTTGG + Intergenic
937237806 2:120441381-120441403 TCTCGAAGGGTGGCAGCTTTGGG + Intergenic
1182824055 22:33247485-33247507 ACGTGATCTGTGGCAGCATTTGG - Intronic
957498376 3:81020647-81020669 TCGGGAAGTCTGGTAGCCTTGGG + Intergenic
958806064 3:98811906-98811928 TCAGGCACTGTGGTAGCCTTTGG + Intronic
968086405 3:195875880-195875902 TCCAGAGCTGGGGCAGCCTTAGG - Intronic
990879432 5:60522832-60522854 TAGGGAACTGTGGCTGACTTGGG - Intergenic
991648177 5:68822476-68822498 TTGCTTCCTGTGGCAGCCTTGGG - Intergenic
995169958 5:109096529-109096551 TCGTGAAGATTGGCAGCCTTAGG - Intronic
998375408 5:141687263-141687285 TGGAGAACTGGGGCAGCCCTGGG + Intergenic
999553907 5:152720515-152720537 TGCCTCACTGTGGCAGCCTTGGG + Intergenic
999845401 5:155474083-155474105 TTGCTCACTGTGGAAGCCTTTGG - Intergenic
1012437193 6:99226831-99226853 TTGCTAAATCTGGCAGCCTTAGG - Intergenic
1017550081 6:155496374-155496396 TCTCAAACTGTGGCTGCATTTGG + Intergenic
1018217167 6:161539747-161539769 CCGGGAACAGTGGCTGCCTTTGG - Intronic
1023165479 7:37339152-37339174 TCTCAAACTGTGGAAGCCCTTGG + Intronic
1023993495 7:45144817-45144839 TCTCCAACTTTGGCAGCATTTGG - Intergenic
1025626511 7:63227149-63227171 TCGTGAGCTGAGTCAGCCTTTGG - Intergenic
1026968514 7:74454485-74454507 TCGCCAACTGCAGCAGCCTGCGG - Intronic
1033100365 7:138464431-138464453 TGGAGAACTGTGTGAGCCTTGGG + Intronic
1042269511 8:66941176-66941198 TTGTGACCTGTGGCAGCCTGCGG + Intergenic
1053110639 9:35456934-35456956 TCCCGAACTCTGGCACCCTGCGG - Intergenic
1058777774 9:108302201-108302223 TCCAGGATTGTGGCAGCCTTTGG + Intergenic