ID: 1069703400

View in Genome Browser
Species Human (GRCh38)
Location 10:70441892-70441914
Sequence TCTAGGGCTCCTGGTTTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069703390_1069703400 15 Left 1069703390 10:70441854-70441876 CCGCAAAGCTGGCGGAGGACCTA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1069703400 10:70441892-70441914 TCTAGGGCTCCTGGTTTGCCCGG No data
1069703389_1069703400 16 Left 1069703389 10:70441853-70441875 CCCGCAAAGCTGGCGGAGGACCT 0: 1
1: 0
2: 1
3: 4
4: 91
Right 1069703400 10:70441892-70441914 TCTAGGGCTCCTGGTTTGCCCGG No data
1069703395_1069703400 -4 Left 1069703395 10:70441873-70441895 CCTAGTTCCAGGGACGGGATCTA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1069703400 10:70441892-70441914 TCTAGGGCTCCTGGTTTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069703400 Original CRISPR TCTAGGGCTCCTGGTTTGCC CGG Intronic
No off target data available for this crispr