ID: 1069705064

View in Genome Browser
Species Human (GRCh38)
Location 10:70453851-70453873
Sequence GAGGGATAACAAAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069705053_1069705064 7 Left 1069705053 10:70453821-70453843 CCAATGGGTTGCCTAGGGATGGG No data
Right 1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG No data
1069705059_1069705064 -4 Left 1069705059 10:70453832-70453854 CCTAGGGATGGGGGAGAGGGAGG No data
Right 1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069705064 Original CRISPR GAGGGATAACAAAGGGCAGA AGG Intergenic
No off target data available for this crispr