ID: 1069705476

View in Genome Browser
Species Human (GRCh38)
Location 10:70456671-70456693
Sequence TTGGCTGCACTTTCCCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069705476_1069705485 5 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705485 10:70456699-70456721 CTCCCTGAGGGCAGAGGTGGGGG No data
1069705476_1069705484 4 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705484 10:70456698-70456720 ACTCCCTGAGGGCAGAGGTGGGG No data
1069705476_1069705482 2 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705482 10:70456696-70456718 AAACTCCCTGAGGGCAGAGGTGG No data
1069705476_1069705488 11 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705488 10:70456705-70456727 GAGGGCAGAGGTGGGGGAGCAGG No data
1069705476_1069705481 -1 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705481 10:70456693-70456715 AGGAAACTCCCTGAGGGCAGAGG No data
1069705476_1069705478 -8 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705478 10:70456686-70456708 GCAGCCAAGGAAACTCCCTGAGG No data
1069705476_1069705479 -7 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705479 10:70456687-70456709 CAGCCAAGGAAACTCCCTGAGGG No data
1069705476_1069705483 3 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705483 10:70456697-70456719 AACTCCCTGAGGGCAGAGGTGGG No data
1069705476_1069705490 15 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705490 10:70456709-70456731 GCAGAGGTGGGGGAGCAGGAGGG No data
1069705476_1069705489 14 Left 1069705476 10:70456671-70456693 CCTTGATGGGAAAGTGCAGCCAA No data
Right 1069705489 10:70456708-70456730 GGCAGAGGTGGGGGAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069705476 Original CRISPR TTGGCTGCACTTTCCCATCA AGG (reversed) Intergenic
No off target data available for this crispr