ID: 1069707052

View in Genome Browser
Species Human (GRCh38)
Location 10:70465531-70465553
Sequence CAGGGTTATTTTGACGATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069707052_1069707060 16 Left 1069707052 10:70465531-70465553 CCGTCATCGTCAAAATAACCCTG No data
Right 1069707060 10:70465570-70465592 ATGTTAGTTTTACAGGTGAGGGG No data
1069707052_1069707059 15 Left 1069707052 10:70465531-70465553 CCGTCATCGTCAAAATAACCCTG No data
Right 1069707059 10:70465569-70465591 TATGTTAGTTTTACAGGTGAGGG No data
1069707052_1069707058 14 Left 1069707052 10:70465531-70465553 CCGTCATCGTCAAAATAACCCTG No data
Right 1069707058 10:70465568-70465590 TTATGTTAGTTTTACAGGTGAGG No data
1069707052_1069707057 9 Left 1069707052 10:70465531-70465553 CCGTCATCGTCAAAATAACCCTG No data
Right 1069707057 10:70465563-70465585 CGTGATTATGTTAGTTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069707052 Original CRISPR CAGGGTTATTTTGACGATGA CGG (reversed) Intergenic
No off target data available for this crispr