ID: 1069708455

View in Genome Browser
Species Human (GRCh38)
Location 10:70474076-70474098
Sequence CACGCTCCTGCCACATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069708454_1069708455 3 Left 1069708454 10:70474050-70474072 CCTGAAGAATGTTCTGGAGCTAG No data
Right 1069708455 10:70474076-70474098 CACGCTCCTGCCACATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069708455 Original CRISPR CACGCTCCTGCCACATGTCC TGG Intergenic
No off target data available for this crispr