ID: 1069714924

View in Genome Browser
Species Human (GRCh38)
Location 10:70514550-70514572
Sequence CCGACTCCTTCATCTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069714924_1069714935 15 Left 1069714924 10:70514550-70514572 CCCCCAAGAGATGAAGGAGTCGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1069714935 10:70514588-70514610 CCTCCATGAAGCCTGTCACCTGG No data
1069714924_1069714936 16 Left 1069714924 10:70514550-70514572 CCCCCAAGAGATGAAGGAGTCGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1069714936 10:70514589-70514611 CTCCATGAAGCCTGTCACCTGGG No data
1069714924_1069714938 19 Left 1069714924 10:70514550-70514572 CCCCCAAGAGATGAAGGAGTCGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1069714938 10:70514592-70514614 CATGAAGCCTGTCACCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069714924 Original CRISPR CCGACTCCTTCATCTCTTGG GGG (reversed) Intronic
900464476 1:2818371-2818393 CCCACTGCTTCAGGTCTTGGTGG + Intergenic
914345414 1:146794574-146794596 CCTTCTCCTTCTTCTCTTCGTGG - Intergenic
916669653 1:167003072-167003094 ACAACTCCTGCATCTCTTTGGGG + Intronic
920493603 1:206438238-206438260 CTCACTCCTTCATCCCCTGGTGG + Intronic
921971942 1:221159473-221159495 ATCACTCTTTCATCTCTTGGAGG + Intergenic
924617369 1:245623474-245623496 CCGATCCATTCATCTCTTGATGG + Intronic
1066307731 10:34162876-34162898 CCCACTCCCTCAACTCCTGGAGG + Intronic
1069714924 10:70514550-70514572 CCGACTCCTTCATCTCTTGGGGG - Intronic
1070075498 10:73130846-73130868 CCCACTCCTTAATCAGTTGGTGG - Exonic
1071436238 10:85650382-85650404 ACGTCTCCTTCATCTCTCTGTGG - Intronic
1073282173 10:102362594-102362616 CTGTCTCCTTCTTCTCTTGCTGG - Exonic
1084447710 11:69213334-69213356 CCGCCTCCTTCAGCTTCTGGGGG - Intergenic
1084749920 11:71197913-71197935 CCGACTCCTTCTTCCCTGGCTGG - Intronic
1086801573 11:91183430-91183452 CCTACCCCTTCATCTCCGGGTGG + Intergenic
1087282671 11:96229229-96229251 GCCATTCATTCATCTCTTGGTGG - Intronic
1088537377 11:110875949-110875971 CTGACTCCTTCCTCTCCTGTAGG - Intergenic
1093520298 12:20042234-20042256 CTGCATCCTACATCTCTTGGTGG - Intergenic
1094768926 12:33631001-33631023 TTGACTCCTTCATGACTTGGAGG + Intergenic
1099240484 12:80132581-80132603 CCTTCTCTTTCATCTCTTGCTGG + Intergenic
1101410468 12:104463763-104463785 CCGGCTCCTTCATTTCCTGCAGG - Intronic
1104613541 12:130250048-130250070 CCCATTCCTTCATCTCTACGTGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114378616 14:22176440-22176462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1115888272 14:37998473-37998495 CCGACTCCCTCATTTACTGGCGG - Intronic
1131260560 15:90885300-90885322 CCTTCTCCTTCCTCTCCTGGGGG + Intronic
1134324447 16:13194098-13194120 CTGACTCCTCCAGTTCTTGGGGG - Intronic
1134773200 16:16828899-16828921 CAGACTGCTTCAACTCATGGTGG + Intergenic
1136553793 16:30996502-30996524 ACGACTCCGTCATCTGATGGGGG + Intronic
1141397655 16:83719099-83719121 CCAGCCCATTCATCTCTTGGGGG + Intronic
1142052241 16:87966280-87966302 CTGAGCCCTGCATCTCTTGGTGG + Intronic
1144012161 17:11159440-11159462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1145276158 17:21432250-21432272 CCCACTCCTTCATCTGTTGCTGG + Intergenic
1145314001 17:21718164-21718186 CGCACTCCTTCATCTGTTGCTGG + Intergenic
1145712449 17:26990141-26990163 CTCACTCCTTCATCTGTTGCTGG + Intergenic
1146370305 17:32261993-32262015 AAAACTCCTTCCTCTCTTGGAGG + Intergenic
1155302852 18:24448162-24448184 GCGTCTTCTTCATCTCATGGAGG + Exonic
1155329477 18:24699978-24700000 AAGACTCCATCATCACTTGGTGG - Intergenic
1158687666 18:59629275-59629297 CTGACTCCCTCATCTCTTTCTGG + Intronic
1158993085 18:62890021-62890043 CCGACTCCTTGTTCTGTAGGGGG + Intronic
1165068159 19:33240903-33240925 CCTTCTCCTTCCTCTCTTGGTGG + Intergenic
1166566622 19:43769548-43769570 CGGACTCCTTCATCTGGGGGTGG + Exonic
927605284 2:24481289-24481311 CCTACTCCTACATCTCCAGGTGG + Intergenic
935701443 2:105815764-105815786 GAGACTCGTTCCTCTCTTGGAGG - Intronic
944886961 2:204072803-204072825 CCGGCACCTGCATCTCTTTGGGG - Intergenic
1170802414 20:19601378-19601400 CCAACTCCTTGAGCTCTTGCTGG - Intronic
1172897654 20:38311855-38311877 CCTACTTGTTCATCTCTAGGTGG + Exonic
1175147194 20:56905890-56905912 CCGATTCCTTCATTTCCTGTTGG + Intergenic
1175461614 20:59155878-59155900 CCTACTCCTTCCTCTCTAGGAGG - Intergenic
1175951829 20:62587752-62587774 CCAACTCCTGCCCCTCTTGGTGG + Intergenic
1178203359 21:30434312-30434334 CCTACTCGTTCAAGTCTTGGGGG - Intergenic
1180682607 22:17638847-17638869 CCGCCTCTTTCATCTCTTCTGGG + Exonic
951132240 3:19061730-19061752 CCCACTCCTTAATCTGTTGTGGG - Intergenic
953390441 3:42530876-42530898 CCGTCTCCTTCTTCTCTGAGCGG + Exonic
955398813 3:58576543-58576565 CCCACGCCTGCATCTCTGGGTGG - Intronic
956096942 3:65726717-65726739 CTGACGCCCTCAGCTCTTGGGGG + Intronic
957767919 3:84649683-84649705 TGAACTCCTTCAGCTCTTGGTGG - Intergenic
958870032 3:99547572-99547594 AAAACTCCTTCATCTCATGGGGG - Intergenic
965680942 3:171250589-171250611 CCAACTCCTTCAGCTGTGGGAGG + Intronic
970966926 4:21938443-21938465 ACTACTCCTTCATATCATGGGGG - Intronic
973946597 4:55962878-55962900 ATGACTCCTTCATCTCTCTGTGG + Intronic
978042946 4:104092431-104092453 CCTACCCCTTCATCTCAGGGAGG - Intergenic
982813895 4:159861590-159861612 CCGTCTCCTTCATCAAATGGTGG + Intergenic
985950665 5:3219464-3219486 GTGACTCCTTCCTCGCTTGGTGG - Intergenic
994220367 5:97188195-97188217 CCGTCACCTTCATTTCTTTGTGG + Intergenic
996404810 5:123094640-123094662 CCTCATCCTTCATCTCCTGGTGG - Intronic
997213054 5:132088947-132088969 CCCAATCCTTCATCTCTAAGAGG + Intergenic
997519809 5:134515771-134515793 CCAACACCTTCAGTTCTTGGTGG + Intergenic
1000125662 5:158241220-158241242 CATATTCCTTCATCTCTTGAAGG - Intergenic
1000243173 5:159427378-159427400 ACGACTGCCTCACCTCTTGGGGG + Intergenic
1000344624 5:160304460-160304482 CCCACACCTTCATCTCCAGGGGG + Intronic
1006067107 6:31470063-31470085 CAGCCTCCTTCAGCTCATGGGGG + Intergenic
1009568545 6:65348117-65348139 CTTACTCATTCATCTGTTGGTGG + Intronic
1010123904 6:72411046-72411068 CCAACCCCTGCATCACTTGGAGG - Intergenic
1010969026 6:82244825-82244847 CTGACTCCCTCTTTTCTTGGTGG - Intronic
1011078939 6:83467990-83468012 CCGACTTCTTCCTCTCTTGTTGG - Intergenic
1024841180 7:53589423-53589445 AGGACTATTTCATCTCTTGGGGG + Intergenic
1028760244 7:94487884-94487906 CGGCCTCATTCATCTCTTGATGG + Intergenic
1032460649 7:132107881-132107903 CAGCCTCCTTCACCTCTTGCAGG + Intergenic
1032662531 7:134001108-134001130 CCATGTCTTTCATCTCTTGGGGG - Intronic
1033491107 7:141844884-141844906 CAGGCTCCTTTATCTTTTGGGGG - Intergenic
1036084682 8:5600462-5600484 CCGCCTCCTTCATCTCTCTAGGG - Intergenic
1037673577 8:21035914-21035936 CCTACTCCTTCCTCACTTGATGG + Intergenic
1039552276 8:38451664-38451686 CAGACTCCTTCAAATCTGGGTGG + Intronic
1041163234 8:55066108-55066130 CCTACTCCTTCACCTCTTCATGG + Intergenic
1050528080 9:6563388-6563410 CCGACTCCTCCACTGCTTGGCGG - Intronic
1052374378 9:27701367-27701389 TAGCCTCCTTCTTCTCTTGGAGG + Intergenic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1059721901 9:116968195-116968217 CCTACTCCTTCTTCTCTTTCTGG + Intronic
1185802886 X:3029418-3029440 CGGTCTCCTTCGTCTCCTGGCGG + Intronic
1186441340 X:9589358-9589380 CTGCCTCCTCCAGCTCTTGGTGG + Intronic
1188513526 X:30961325-30961347 CAGGCACCTTCATCACTTGGTGG - Intronic
1192040978 X:67621232-67621254 CCAACTCCTTCATCATTTGGGGG - Intronic
1194933182 X:99914397-99914419 CTGAATTCTTCATATCTTGGTGG - Intergenic
1201894975 Y:18983410-18983432 CCGCCTCTTCCAGCTCTTGGTGG + Intergenic