ID: 1069716188

View in Genome Browser
Species Human (GRCh38)
Location 10:70522933-70522955
Sequence GTGTGTGGCCAGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069716179_1069716188 13 Left 1069716179 10:70522897-70522919 CCCAGAGAGGGGAAGGAAGTGGT 0: 1
1: 0
2: 9
3: 73
4: 577
Right 1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG No data
1069716180_1069716188 12 Left 1069716180 10:70522898-70522920 CCAGAGAGGGGAAGGAAGTGGTC 0: 1
1: 0
2: 7
3: 57
4: 409
Right 1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG No data
1069716183_1069716188 -10 Left 1069716183 10:70522920-70522942 CCAAGGCCCTTCAGTGTGTGGCC 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069716188 Original CRISPR GTGTGTGGCCAGCAGGAGGA AGG Intronic
No off target data available for this crispr