ID: 1069716966

View in Genome Browser
Species Human (GRCh38)
Location 10:70527337-70527359
Sequence GCCATGAGCACAGCACTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069716958_1069716966 22 Left 1069716958 10:70527292-70527314 CCGTAAAAATCCTGTACACAGGG 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1069716966 10:70527337-70527359 GCCATGAGCACAGCACTTTTTGG No data
1069716960_1069716966 12 Left 1069716960 10:70527302-70527324 CCTGTACACAGGGCTGTGCTTAG 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1069716966 10:70527337-70527359 GCCATGAGCACAGCACTTTTTGG No data
1069716956_1069716966 26 Left 1069716956 10:70527288-70527310 CCAGCCGTAAAAATCCTGTACAC 0: 1
1: 0
2: 0
3: 9
4: 46
Right 1069716966 10:70527337-70527359 GCCATGAGCACAGCACTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069716966 Original CRISPR GCCATGAGCACAGCACTTTT TGG Intronic
No off target data available for this crispr