ID: 1069720959

View in Genome Browser
Species Human (GRCh38)
Location 10:70549073-70549095
Sequence TGTTAAATGTGGGGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069720951_1069720959 5 Left 1069720951 10:70549045-70549067 CCAAAAAAAAAAAAAAAAAAAAA 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
Right 1069720959 10:70549073-70549095 TGTTAAATGTGGGGAGGGGAAGG No data
1069720950_1069720959 16 Left 1069720950 10:70549034-70549056 CCTTGTCTCTACCAAAAAAAAAA 0: 501
1: 3649
2: 17203
3: 132169
4: 252871
Right 1069720959 10:70549073-70549095 TGTTAAATGTGGGGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069720959 Original CRISPR TGTTAAATGTGGGGAGGGGA AGG Intronic
No off target data available for this crispr