ID: 1069721420

View in Genome Browser
Species Human (GRCh38)
Location 10:70551951-70551973
Sequence CACGAAGCCCAGAAGGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069721420_1069721424 13 Left 1069721420 10:70551951-70551973 CCCGTTTCCTTCTGGGCTTCGTG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1069721424 10:70551987-70552009 CTCTCTGGAAGCTGTGATTGTGG No data
1069721420_1069721426 24 Left 1069721420 10:70551951-70551973 CCCGTTTCCTTCTGGGCTTCGTG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1069721426 10:70551998-70552020 CTGTGATTGTGGCAGGCCCACGG No data
1069721420_1069721423 -2 Left 1069721420 10:70551951-70551973 CCCGTTTCCTTCTGGGCTTCGTG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1069721423 10:70551972-70551994 TGCACTTGCATGCAGCTCTCTGG No data
1069721420_1069721425 17 Left 1069721420 10:70551951-70551973 CCCGTTTCCTTCTGGGCTTCGTG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1069721425 10:70551991-70552013 CTGGAAGCTGTGATTGTGGCAGG No data
1069721420_1069721427 25 Left 1069721420 10:70551951-70551973 CCCGTTTCCTTCTGGGCTTCGTG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1069721427 10:70551999-70552021 TGTGATTGTGGCAGGCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069721420 Original CRISPR CACGAAGCCCAGAAGGAAAC GGG (reversed) Intronic
901743144 1:11355600-11355622 CACGGGGCCCAGAAGGAATCAGG - Intergenic
902683128 1:18057950-18057972 CAAGAAGCCAAGAAGGAGGCTGG - Intergenic
904896991 1:33824892-33824914 CACTCGGCCCAGAAGGAAAGTGG + Intronic
911028280 1:93458076-93458098 CACGACGCCCGGCCGGAAACAGG + Intronic
915142733 1:153777182-153777204 CACGATGCCCAGCAGGGAACCGG - Exonic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
919733744 1:200931163-200931185 CAAGAAGCACAGTTGGAAACAGG - Intergenic
921794473 1:219326527-219326549 CAAGAATCCCAGAAGGGAATTGG - Intergenic
923392186 1:233523456-233523478 CACAATGCCCCAAAGGAAACTGG + Intergenic
924607991 1:245551699-245551721 CCGGAAGCCCAGAAGGAAGTTGG + Intronic
924920393 1:248623071-248623093 CACACAGCCCAGAAAGAAATAGG + Intergenic
1065976166 10:30844898-30844920 CACGAAGCTCTGAAGGAAGGTGG + Exonic
1068224219 10:54085701-54085723 CACACAGCCAAGAAAGAAACTGG - Intronic
1069701027 10:70426062-70426084 CAAGAAGCCCAGGAAGAAATGGG - Exonic
1069721420 10:70551951-70551973 CACGAAGCCCAGAAGGAAACGGG - Intronic
1071984162 10:91034152-91034174 CTCGAAGCCCAGGAGGACACTGG + Intergenic
1073183684 10:101602332-101602354 CACGAGGCCCACAGGGAAGCAGG + Intronic
1075444271 10:122502992-122503014 CAGTAAGCCTAGAAGTAAACAGG - Intronic
1076511170 10:131014591-131014613 CACCACGCCCAGAAGACAACAGG + Intergenic
1077228922 11:1450118-1450140 CAGGAGGACCAGAAAGAAACAGG - Intronic
1078973233 11:16439997-16440019 CACCAAGCACTGAAGGAAACAGG + Intronic
1080183313 11:29449365-29449387 CAGCAAGCCAAAAAGGAAACAGG + Intergenic
1080433092 11:32216442-32216464 CACGAGGCCCACAAGGCAATGGG + Intergenic
1084213135 11:67633050-67633072 CACGAAGACCACGTGGAAACGGG + Exonic
1090093164 11:123717508-123717530 CACTAAGCCCAGGAGGAGAATGG + Intergenic
1090598791 11:128347911-128347933 CATCAAGCCCAGAAAGACACTGG + Intergenic
1092028075 12:5259713-5259735 CACGATGCCTAGAAGGCTACGGG + Intergenic
1095623172 12:44282854-44282876 CCGGAAGCCCAGGAGGAAAGTGG + Intronic
1095841924 12:46702605-46702627 CACAAAACCCAAAAGGTAACAGG - Intergenic
1104819541 12:131666900-131666922 CCAGGACCCCAGAAGGAAACGGG + Intergenic
1106511618 13:30418142-30418164 CACGAAGCAGAGAAGAAAGCTGG + Intergenic
1106575900 13:30974588-30974610 CACGAATTTCAGAATGAAACAGG - Intronic
1108594356 13:51937199-51937221 CACTAACCCCAGCAGGAACCTGG + Intronic
1112170352 13:96966662-96966684 CACGTAGCCCACAAAAAAACTGG - Intergenic
1113483533 13:110638532-110638554 CGCGCAGACCAGAAGTAAACAGG + Exonic
1113499681 13:110763657-110763679 CACGGAACCCAAAAGGAACCGGG - Intergenic
1117257235 14:53990488-53990510 CATGAAGCCCAAAGGGGAACAGG - Intergenic
1117911511 14:60642164-60642186 CAGGAAGCGAAGAAGGAGACAGG + Intergenic
1121239327 14:92416827-92416849 CACCAAGCCTAGAAGGAATGAGG + Intronic
1122527393 14:102397320-102397342 CACGAGGCACACAAAGAAACAGG + Intronic
1122629455 14:103100633-103100655 CACGAAGCATGAAAGGAAACGGG + Intronic
1122839627 14:104450975-104450997 CACGGAGTCCAGAGGGAAATCGG + Intergenic
1125403786 15:39332335-39332357 CACTAAGACCTGAAGGAAAGAGG + Intergenic
1126067547 15:44837608-44837630 CAAGAAGCCAAGGAGGAAGCAGG + Intergenic
1127561256 15:60138608-60138630 CACCAAGCCAAGGAGGAACCTGG + Intergenic
1129190823 15:73936677-73936699 GAGGAAGCCAAGAGGGAAACAGG + Intronic
1131715104 15:95101041-95101063 CATGAAGCCCAGAAGGCAGTGGG + Intergenic
1132150118 15:99453169-99453191 CATGAAGCCCATCAGAAAACAGG + Intergenic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1134090398 16:11388522-11388544 CACGAGGCCCACCAGGAACCGGG - Intronic
1134097002 16:11424650-11424672 CACAAATCTCAGAGGGAAACAGG + Intronic
1134132505 16:11659222-11659244 CACGAATCTCAGCGGGAAACAGG + Intergenic
1134462600 16:14442551-14442573 CTAGAAGCCCTGAAGGAGACTGG + Intronic
1137362957 16:47836961-47836983 CAGAAAGCCCAGAAATAAACTGG + Intergenic
1137411544 16:48232492-48232514 CACAGACCCCAGAAGGAATCTGG + Intronic
1137852094 16:51756030-51756052 CAGGAACCCCAGAAGGCAACAGG + Intergenic
1138224114 16:55277916-55277938 AACCCAGCCCAGAAGTAAACTGG + Intergenic
1138640104 16:58378897-58378919 CCAGAAGACCAGAAGGATACAGG - Intronic
1138640789 16:58384750-58384772 CCAGAAGACCAGAAGGATACAGG - Intronic
1139789885 16:69424979-69425001 CACGACCCTCAGAGGGAAACTGG + Intronic
1139854498 16:69969652-69969674 CAAGAAGCCCCAAAGGAAACAGG - Intergenic
1139883477 16:70192567-70192589 CAAGAAGCCCCAAAGGAAACAGG - Intergenic
1140369033 16:74402952-74402974 CAAGAAGCCCCAAAGGAAACAGG + Intergenic
1140876675 16:79159072-79159094 CACCAAGCCCAGAAGCCTACTGG - Intronic
1141055094 16:80806322-80806344 GAAGAAGACAAGAAGGAAACTGG + Intergenic
1143745639 17:8992104-8992126 CACCAACCACAGAAGGAAGCCGG - Intergenic
1146134435 17:30306143-30306165 CAGCATTCCCAGAAGGAAACTGG - Intergenic
1146619996 17:34389684-34389706 CACGCAGACCAGATGGAAGCTGG - Intergenic
1147546926 17:41408927-41408949 CTCAAAGCCCAGAAAGCAACAGG + Intergenic
1148330876 17:46813275-46813297 AATGAAGCCCAGAAGGAGGCAGG + Intronic
1148389085 17:47257346-47257368 GAAGAAGCCAAGAAGGAAAAAGG + Intronic
1148862820 17:50613416-50613438 CAAGAGGCCCAGAAGGAAGGCGG - Intronic
1150233563 17:63573868-63573890 CAGGGAGCCCAGAGGGGAACAGG - Intronic
1152620588 17:81362558-81362580 CAGGAAGCACCCAAGGAAACAGG - Intergenic
1157675495 18:49565603-49565625 CAAGCAGCCCACAAGGAAAGGGG - Intronic
1157689396 18:49668791-49668813 CACGAAGCCTAGAGGGAGAGTGG - Intergenic
1159294893 18:66472326-66472348 CAAGAAGACCCCAAGGAAACAGG - Intergenic
1160179353 18:76620376-76620398 CACAAAGACCAGAGGCAAACTGG - Intergenic
1160352381 18:78194683-78194705 CATGAAGCTCAGGAGGAAACTGG - Intergenic
1160556032 18:79725843-79725865 CACGGAGCCCAGAAGGAAGCCGG - Intronic
1163200010 19:15760311-15760333 CACGGAGCCCCGCAGGAAGCCGG - Intergenic
1164623048 19:29708794-29708816 CACAAAGCCCAGCAGAGAACGGG + Intronic
1164678582 19:30119284-30119306 CACTGAGCCCAGAAAGAAACGGG - Intergenic
1165450230 19:35878153-35878175 CCCTGAACCCAGAAGGAAACAGG + Intronic
1166050371 19:40255597-40255619 AACTAAGCCCTGAAGGAAAAGGG + Intronic
1166411547 19:42558672-42558694 CACGTAGCCCAAGAAGAAACTGG - Intronic
1167655166 19:50759029-50759051 CAGGAAGCCCAGCAGGAAGTGGG - Intergenic
1167707907 19:51092584-51092606 CAAGAAGCTGAGATGGAAACTGG - Intergenic
1167803365 19:51761189-51761211 CAGGAAGCCAAGAAGCACACAGG + Intronic
929057354 2:37889895-37889917 CAGATAGCCCAGAAGGAAAATGG - Intergenic
930154620 2:48093362-48093384 CATGGAGCCCAAAAAGAAACAGG - Intergenic
932430115 2:71669023-71669045 CAAGAAGCCAAGAAGCAGACTGG - Intronic
932571049 2:72938564-72938586 CAGGAGTCCCAGCAGGAAACTGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
938263716 2:129911967-129911989 AACGGAGCCCAGCAGGAAGCGGG + Intergenic
940348471 2:152653261-152653283 CTCTAAGACCAGAAGAAAACCGG + Exonic
942389478 2:175477200-175477222 CATGAAGCCAAGTAGAAAACGGG + Intergenic
943043302 2:182828536-182828558 CACTAAGCCCAGAAGAAAAGTGG - Intergenic
945494428 2:210492519-210492541 CATGAAGCCTAGAGGGCAACTGG + Intronic
947035993 2:225856499-225856521 CATGAAGGCCAGAAAGAAGCAGG - Intergenic
948911332 2:241004639-241004661 CATGAGGGCCAGAAGGAAAATGG - Intronic
1169720976 20:8676060-8676082 CACAAAGCCCAGATGAAAGCAGG + Intronic
1172461172 20:35119989-35120011 GATCAAGCCCAGGAGGAAACAGG - Intronic
1173335637 20:42110389-42110411 GACGAAGCCCAGAAGGCCAGTGG + Exonic
1175191116 20:57212778-57212800 AAAGGAGCCCAGAAGGAAGCCGG + Intronic
1176170425 20:63694081-63694103 TACCAAGCCCAGAAGGGATCTGG - Intronic
1177015623 21:15783354-15783376 CAAGAAGTGCAGAAGGACACAGG - Intronic
1177923715 21:27187111-27187133 CATGAAGCCCAAAAGAAATCTGG + Intergenic
1178605157 21:34029865-34029887 CACGTAGCCCAGATGGAAGCGGG + Intergenic
1179379837 21:40888287-40888309 CACGAAGCTCTGAAACAAACAGG + Intergenic
1180610634 22:17095435-17095457 CATGAAGACCACAAGGAAAGTGG - Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182018605 22:27061913-27061935 CAAGGAGCCCAGGAGGAGACTGG - Intergenic
1183220018 22:36506476-36506498 CACGAGGCCCAGAAAGAGGCGGG + Intronic
1183509431 22:38226394-38226416 CACTAAGCCCAGAATGAAATGGG + Intronic
1183604611 22:38861116-38861138 CCCAAAGCCCAGAAGGGAGCAGG - Intergenic
951129724 3:19027775-19027797 AATGAAGCCCAGAAGGCAATAGG + Intergenic
955621691 3:60871079-60871101 CAAGAACCACAGATGGAAACGGG - Intronic
958254682 3:91311932-91311954 CATGAAGACCAGAAGAAAATGGG + Intergenic
960589722 3:119353854-119353876 CAAGAAGCCAAGAAGGGAATGGG - Intronic
961981295 3:131081857-131081879 AAAGAAGCTCAGAAGGAAAAGGG + Intronic
963001727 3:140687973-140687995 AAGGAAGCCCTGAAGGAGACTGG + Exonic
963552954 3:146747728-146747750 CACCAAACACAGATGGAAACTGG - Intergenic
964373718 3:156028891-156028913 CACGAAGATAAGATGGAAACTGG - Intergenic
965207167 3:165735969-165735991 AACAAAAGCCAGAAGGAAACAGG + Intergenic
968171990 3:196518178-196518200 CACGTAGCCCACAAAAAAACTGG - Intergenic
970289239 4:14553377-14553399 CATGAAACCCAGCAGGCAACTGG + Intergenic
972953668 4:44361955-44361977 CACGAATCTCAGAAAGAAAAAGG + Intronic
975418367 4:74133141-74133163 CATGTAGGCCAGAAGGAAATAGG - Intronic
975542691 4:75531181-75531203 CCAGACTCCCAGAAGGAAACTGG - Intronic
975903159 4:79177326-79177348 GAGGAAGCCCAGAAGTTAACAGG - Intergenic
977087891 4:92628207-92628229 CATGGACACCAGAAGGAAACAGG - Intronic
977565628 4:98577633-98577655 GACGAAGCCCTGAGGAAAACTGG + Intronic
978114730 4:105005624-105005646 CTGGAATCCCAGAAGGAAAGAGG - Intergenic
979949274 4:126872646-126872668 CATCAAGACCAGAAGGAAATGGG + Intergenic
983326394 4:166262893-166262915 CATGAAGACCAGAAGCAAGCTGG - Intergenic
984555820 4:181212833-181212855 CATGAAGTCCAGAATGTAACTGG + Intergenic
984816815 4:183846126-183846148 CACGGAGGCCAGAAGGCAATAGG - Intergenic
986654595 5:9998904-9998926 TACGAAGGACAGAAGGAATCAGG - Intergenic
987577945 5:19754611-19754633 CAGAAAGCCAACAAGGAAACTGG + Intronic
989283673 5:39673999-39674021 CACGATGCTCAGAAGGACATTGG - Intergenic
993358646 5:86946015-86946037 AAGGAAGCCCTGAAGGAAGCAGG + Intergenic
995539348 5:113169277-113169299 CAAGAAACCCAGAAGGAGAAAGG + Intronic
996551625 5:124736399-124736421 CAGGAAATCCAGAAGTAAACTGG + Intronic
996599808 5:125249770-125249792 CAGGAAGGTCAGAAAGAAACAGG - Intergenic
997819673 5:137053618-137053640 GCCGAAGCCCAGAAAGAACCTGG - Intronic
1001837771 5:174846108-174846130 GACGAAGCTCAGAAGGGAACTGG + Intergenic
1002106684 5:176882721-176882743 CAAGAAGCACAGAAAGAAAAAGG + Intronic
1002366606 5:178717404-178717426 CAGGAAGCTGAGAGGGAAACAGG + Intronic
1006332904 6:33405091-33405113 CACCAGGGCCAGAGGGAAACAGG - Exonic
1008397113 6:51021800-51021822 CACAAATGTCAGAAGGAAACTGG + Intergenic
1009718729 6:67435679-67435701 CCTGTTGCCCAGAAGGAAACAGG + Intergenic
1009830966 6:68933871-68933893 CATGAAACACAAAAGGAAACTGG - Intronic
1011349672 6:86408659-86408681 GACGTCGCCCAGAAGGAAAAGGG + Intergenic
1011688579 6:89844625-89844647 TAAGACTCCCAGAAGGAAACAGG + Intronic
1014726081 6:124973493-124973515 CACAAAGCCCAGAAGAGAATAGG + Intronic
1017845673 6:158255946-158255968 CACGAGGCCCAGCAAGAAAAGGG - Intronic
1018048212 6:159983657-159983679 CATCAGGCCCAGCAGGAAACGGG - Intronic
1018616622 6:165692558-165692580 CACGAAGACCAGCAGGAGAGAGG - Intronic
1020028854 7:4919198-4919220 AACGAAGCCCAGAGGGGAGCTGG + Intronic
1021508687 7:21411948-21411970 CAAGAAGCCCACAGGGAAGCTGG - Intergenic
1022509806 7:30927844-30927866 CACCTGGCCCAGAAGGAAGCAGG + Intergenic
1023099148 7:36696101-36696123 TAGGAAGCCCAGAAATAAACTGG - Intronic
1024674113 7:51622847-51622869 CAAGAAGGCCAAAAGGAAATAGG + Intergenic
1027814749 7:82954027-82954049 AAGAAAGCCAAGAAGGAAACTGG - Exonic
1029966301 7:104744406-104744428 CACAAATCCCATCAGGAAACAGG - Intronic
1034532264 7:151703189-151703211 CGCGAAGCAAAGAAGGAAAGAGG + Intronic
1036092590 8:5683612-5683634 CACAAAGGCCAGCAGGAACCAGG + Intergenic
1036115756 8:5959187-5959209 CAGGGAGCCCAGAAGCAAAAGGG + Intergenic
1038524709 8:28262987-28263009 CAGGAAGACCTGAAGGAAAGGGG + Intergenic
1038661580 8:29501985-29502007 CAGGAAGACCAGAATGAAAGGGG + Intergenic
1039334224 8:36572263-36572285 CAAGAAGTCAAGAAGGAAAAAGG - Intergenic
1043400290 8:79877781-79877803 CGGGAAGCCCAGAAGCAAAAGGG - Intergenic
1044307114 8:90650558-90650580 CACCAAACCCAGAAGAAAAAGGG - Intronic
1044933934 8:97276193-97276215 CACGAAGCCCAGCAAGTCACTGG + Exonic
1044948639 8:97414601-97414623 GCCGAAGCCCAGCAGAAAACTGG - Intergenic
1048142373 8:131806930-131806952 CACGAAGACCAGAAGGGAAGAGG - Intergenic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1049278565 8:141732262-141732284 CAGGGAGCCCAGAAGGACAATGG - Intergenic
1049481395 8:142825423-142825445 CACCAGGACCAGAAGGAAAATGG - Intergenic
1053249025 9:36559085-36559107 CATGGAGCCCAGAGGGAAAAAGG - Intergenic
1053476330 9:38384548-38384570 AAGGAAGCCCAGAGGGAAGCAGG - Intergenic
1055295380 9:74827811-74827833 AATGAAGCTCAGAAGGAACCTGG - Exonic
1057255180 9:93540596-93540618 GACACAGCCCAGAAAGAAACAGG - Intronic
1057918079 9:99072755-99072777 CATGAAGTCCAGGAGGAGACGGG - Intergenic
1060679324 9:125547244-125547266 CACGGAGCCCACAGGGACACAGG + Intronic
1061115735 9:128610399-128610421 CCCAAAGCCAAGAAGGAAAAGGG - Intronic
1062541808 9:137044875-137044897 CACTGAGCCCAGGAGGAAGCCGG + Intronic
1186401123 X:9260993-9261015 CAGGAAGGCCAGCAGGAATCAGG + Intergenic
1186967271 X:14801670-14801692 CACGATCCCCAGAAGGATATAGG - Intergenic
1187830345 X:23374641-23374663 GATGAAACCCAGAAGGAAAACGG - Intronic
1190129322 X:47732613-47732635 TAGGAAGCTCAGAAGGAAACTGG - Intergenic
1192543032 X:71991099-71991121 CACGAAGCCCAGAAAGAGGAAGG - Intergenic
1193748288 X:85310906-85310928 CATGAAGCCCAGAAGGAACTAGG + Intronic
1197157978 X:123291057-123291079 CACAAGGCCCTGAGGGAAACAGG + Intronic
1199671413 X:150151244-150151266 TACTAAGCACCGAAGGAAACTGG - Intergenic
1200324755 X:155224815-155224837 CAGGAATCCCAGAAAGAAAGAGG - Intronic
1201677747 Y:16605960-16605982 CTGGAATCCCAGAAGGAAAGGGG + Intergenic