ID: 1069722202

View in Genome Browser
Species Human (GRCh38)
Location 10:70556968-70556990
Sequence CTTTCTAGTGAGTGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069722191_1069722202 17 Left 1069722191 10:70556928-70556950 CCAGGACCCTGCCTGGCACAAGT 0: 1
1: 0
2: 3
3: 37
4: 265
Right 1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG No data
1069722197_1069722202 6 Left 1069722197 10:70556939-70556961 CCTGGCACAAGTAGGGGCTCCAC 0: 1
1: 0
2: 0
3: 28
4: 167
Right 1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG No data
1069722195_1069722202 11 Left 1069722195 10:70556934-70556956 CCCTGCCTGGCACAAGTAGGGGC 0: 1
1: 1
2: 3
3: 21
4: 158
Right 1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG No data
1069722196_1069722202 10 Left 1069722196 10:70556935-70556957 CCTGCCTGGCACAAGTAGGGGCT 0: 1
1: 0
2: 2
3: 17
4: 147
Right 1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG No data
1069722188_1069722202 25 Left 1069722188 10:70556920-70556942 CCCTGACTCCAGGACCCTGCCTG 0: 1
1: 0
2: 6
3: 42
4: 419
Right 1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG No data
1069722189_1069722202 24 Left 1069722189 10:70556921-70556943 CCTGACTCCAGGACCCTGCCTGG 0: 1
1: 0
2: 6
3: 46
4: 417
Right 1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069722202 Original CRISPR CTTTCTAGTGAGTGGATGGA GGG Intronic
No off target data available for this crispr