ID: 1069722779

View in Genome Browser
Species Human (GRCh38)
Location 10:70560280-70560302
Sequence AAGAGTGAGCAGGGAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069722770_1069722779 19 Left 1069722770 10:70560238-70560260 CCGACCAGGCAGGAGGAACAGCA 0: 1
1: 1
2: 10
3: 68
4: 407
Right 1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG No data
1069722769_1069722779 20 Left 1069722769 10:70560237-70560259 CCCGACCAGGCAGGAGGAACAGC 0: 1
1: 1
2: 3
3: 32
4: 308
Right 1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG No data
1069722772_1069722779 15 Left 1069722772 10:70560242-70560264 CCAGGCAGGAGGAACAGCATGGG No data
Right 1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069722779 Original CRISPR AAGAGTGAGCAGGGAGTGGT GGG Intronic
No off target data available for this crispr