ID: 1069723684

View in Genome Browser
Species Human (GRCh38)
Location 10:70564556-70564578
Sequence TGGCTCCTGCAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069723680_1069723684 -4 Left 1069723680 10:70564537-70564559 CCGAGAGGGGCCGGGGCGATGGC 0: 1
1: 0
2: 0
3: 12
4: 203
Right 1069723684 10:70564556-70564578 TGGCTCCTGCAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 272
1069723670_1069723684 27 Left 1069723670 10:70564506-70564528 CCTGGATGCAGGAGGTGAGGGGA 0: 1
1: 0
2: 6
3: 46
4: 471
Right 1069723684 10:70564556-70564578 TGGCTCCTGCAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069723684 Original CRISPR TGGCTCCTGCAGATGGAGCT GGG Intronic
900096762 1:942955-942977 CGGCCCCTCCAGCTGGAGCTTGG - Exonic
900139259 1:1132636-1132658 TTGTTCCAGCAGCTGGAGCTAGG - Intergenic
900318052 1:2069244-2069266 TGGGGCCTGCAGCTGGGGCTGGG - Intronic
900710205 1:4108756-4108778 TGGCTGCTTCACAGGGAGCTGGG - Intergenic
900945212 1:5827426-5827448 TGGCACCTGCAGTTGGTGCTGGG - Intergenic
900978178 1:6030282-6030304 TGGCTCTTGCATATGTAGCAGGG + Intronic
901225393 1:7610346-7610368 TGGCTCCTGCACATTGTGCTTGG + Intronic
902223936 1:14984635-14984657 TGGCTCCTTCTGATGGAGACTGG - Intronic
903211636 1:21822380-21822402 AGGCTCCTGCAGATGGGGCAGGG + Exonic
903381565 1:22900600-22900622 TGGCTCCAGGAGACGGAGCATGG - Intronic
903758035 1:25676636-25676658 TGGCCCCTGCAAATGGGGCCAGG + Intronic
904365443 1:30008141-30008163 TGGCACCGGCAGCTGAAGCTTGG + Intergenic
906652117 1:47520307-47520329 TGGGCCATGCAGTTGGAGCTAGG - Intergenic
907387333 1:54134502-54134524 TGGCTGCTGCAGATTGGGCGTGG - Intronic
907930025 1:58990597-58990619 TGGCTCCTGCTGGTGTAGGTTGG + Intergenic
908299427 1:62748496-62748518 TAGCTCCTTCAGAGGGAGCATGG - Intergenic
910374341 1:86552665-86552687 TCGGACTTGCAGATGGAGCTGGG + Intronic
911230838 1:95359976-95359998 TGGCTGCTGGAGAGGGAGCCAGG + Intergenic
912099787 1:106190964-106190986 TGGTTCCTGCAAATGCAGATAGG - Intergenic
914846165 1:151284539-151284561 TGGCACCTGGAGATCTAGCTTGG - Intronic
915551515 1:156638125-156638147 TGGCTCCTGCTGGTGCAGCAGGG + Intergenic
920006094 1:202834960-202834982 TGGCTCCTGCAGAGGAGGCAGGG - Intergenic
920006308 1:202836020-202836042 TGGGTCCTGGAGATGGAGAGAGG - Intergenic
920350860 1:205337065-205337087 TGCCTCCTGGAGATGGGGGTGGG + Exonic
920743621 1:208604862-208604884 TGGGTCCTGCAGATGATGCCTGG + Intergenic
923558728 1:235022172-235022194 TGTCTCCTGCAGAATGAGCACGG + Intergenic
923740198 1:236647702-236647724 TGGATCCTGCAGTAGGAGTTGGG - Intergenic
924034717 1:239924710-239924732 TGGATCCTGCACGGGGAGCTAGG + Intergenic
924549630 1:245063400-245063422 TGGCTCCTGAACTAGGAGCTAGG - Intronic
924876784 1:248115004-248115026 TGGCTACTTCAAATGGAGCAGGG + Intergenic
1062815152 10:493931-493953 TGTCTCCTGTAGTTGGAGGTAGG - Intronic
1063505407 10:6593627-6593649 GGGCTGATGCAGCTGGAGCTGGG - Intergenic
1069723684 10:70564556-70564578 TGGCTCCTGCAGATGGAGCTGGG + Intronic
1069959952 10:72073723-72073745 AGGCCCCTGCAGCTGGAGCAGGG - Intronic
1071189355 10:83081891-83081913 TGCCTCATGCAGATGTAGATAGG + Intergenic
1071455570 10:85849071-85849093 TGGCTCCAGCAGTTGGTGCTAGG - Intronic
1074190539 10:111131466-111131488 GGGCTCCTGAAGATGGCGTTAGG - Intergenic
1075126364 10:119703240-119703262 TGGCGCCTTCAGAGGGAGCCTGG + Intergenic
1075842450 10:125516486-125516508 TGGCCTCTGGAGATGGAGCTTGG + Intergenic
1076109961 10:127852596-127852618 TGGCTTCTGGAGATGGAGGATGG - Intergenic
1076381100 10:130025021-130025043 TGGGCCCTGGAGATGGAGCCGGG - Intergenic
1076700296 10:132269454-132269476 TGGCTGCTGCAGGAGGACCTGGG + Intronic
1077131281 11:974007-974029 TGGCTCCTGCAGCAGGTCCTCGG - Intronic
1078994783 11:16686004-16686026 TGGCTGCTGCAGCTCTAGCTGGG - Intronic
1079058891 11:17230264-17230286 TAGCTCCAGCAGAGGGAGCCAGG + Intronic
1080682845 11:34492117-34492139 CGGCTCCAGAAGAAGGAGCTTGG - Intronic
1083612005 11:64008748-64008770 CGGCTCCTGCAGTTTGAGCGGGG + Intronic
1083629141 11:64086846-64086868 TGGCGGCTGGGGATGGAGCTGGG + Intronic
1084784663 11:71435281-71435303 AGGCTCCTCGAGTTGGAGCTGGG + Exonic
1085783565 11:79431591-79431613 TGGATCCTGGAGAGGGTGCTGGG - Intronic
1088616590 11:111635851-111635873 TGGCAGCTGCAGTTGTAGCTAGG + Intronic
1089400887 11:118164013-118164035 GGGCCCCAGCAGATGGGGCTGGG - Exonic
1090335080 11:125956698-125956720 TGTCTCCTGCAGAGGCGGCTCGG - Exonic
1090618205 11:128536189-128536211 TGTCTCCTCCAGATGCAGCTTGG + Intronic
1090756004 11:129792557-129792579 TGCCTCCAGCAGCAGGAGCTTGG - Intergenic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091605615 12:1949104-1949126 TGCCTCCTGGAGCTGGAGCTTGG + Exonic
1093804204 12:23411870-23411892 GTGCTCCTGCAGAGGGAGGTAGG + Intergenic
1094496965 12:30994655-30994677 GGGCTCCTGGAGATGGGGCTAGG - Exonic
1094853947 12:34394634-34394656 TGGGCCCTGCACATGGAGTTTGG - Intergenic
1095966392 12:47870062-47870084 TGGGTCTGGCAGTTGGAGCTGGG - Intronic
1096323867 12:50640809-50640831 TGGCTCCCCCAGATCGAGTTCGG - Exonic
1097649615 12:62280784-62280806 AGGCTCTTGCAGCTGGATCTGGG + Intronic
1097767463 12:63542515-63542537 TGTCTCCTGCAGAGAGAGATGGG - Intergenic
1097783834 12:63737558-63737580 TGTCTCCTGCAGAGAGAGATGGG - Intergenic
1101533024 12:105591842-105591864 TGGCTCCTGAGGATGGAGGAAGG - Intergenic
1101879051 12:108614089-108614111 TGGCTCCTTGAGAAGGGGCTGGG - Intergenic
1102328996 12:112013437-112013459 GGGTTCCTGCAGAGGGAGGTAGG - Exonic
1102576292 12:113858156-113858178 TTGCTCCTGCAGTGGGTGCTGGG - Intronic
1103331398 12:120156717-120156739 TGGGTCCTGCCACTGGAGCTGGG - Intronic
1104751414 12:131242181-131242203 TGGCTCCAGCCAATGGAGATAGG - Intergenic
1105449750 13:20488837-20488859 TGGTCCCTGCAGGTGGAGCTGGG - Intronic
1105703992 13:22957634-22957656 TGGCACCTCCAGCTGCAGCTGGG + Intergenic
1105813568 13:24014125-24014147 TGGCACCTGCAAAAGGAGCATGG - Intronic
1106159132 13:27184982-27185004 TTGCTCCTGGAGCTGGGGCTAGG + Intergenic
1106468287 13:30032238-30032260 TGGCTACTGAAAATGGAGCCTGG + Intergenic
1109836996 13:67873085-67873107 TGGCTGCTGAAGATGAAGGTGGG + Intergenic
1111193798 13:84845202-84845224 TGCCTCCTGCCCAAGGAGCTGGG - Intergenic
1113598149 13:111548656-111548678 TGGCTCCTGAAGCTGCAGCTGGG + Intergenic
1117024543 14:51606714-51606736 TGGCTCATGCAAATGGAGGCTGG + Intronic
1118040321 14:61909391-61909413 TGGCACCTTCAGAGGGAGCATGG - Intergenic
1119767973 14:77202485-77202507 TAGGTCCTGCAGAGGGAGCACGG - Intronic
1121719139 14:96097151-96097173 TGGCTCCTGCAGGTGCTGCTGGG + Intergenic
1122145736 14:99687950-99687972 TGGCACCTGCAGGGGGCGCTGGG - Intronic
1122845706 14:104496963-104496985 TGGCACCTCCAGCTGCAGCTGGG + Intronic
1122878469 14:104679423-104679445 TGGCTGCTGCGGCTGGGGCTGGG - Intergenic
1123135301 14:106022255-106022277 TGACTCCTGCAGCTGCACCTGGG + Intergenic
1123164670 14:106314929-106314951 TGACTCCTGCAGCTGCACCTGGG + Intergenic
1123168588 14:106349561-106349583 GGACTCCTGCAGCTGCAGCTGGG + Intergenic
1123176275 14:106421987-106422009 CGACTCCTGCAGCTGCAGCTGGG + Intergenic
1123585842 15:21760115-21760137 TGACTCCTGCAGCTGCACCTGGG + Intergenic
1123622484 15:22202703-22202725 TGACTCCTGCAGCTGCACCTGGG + Intergenic
1124688907 15:31805328-31805350 AGGCTCCTGTAGATGCACCTTGG + Intronic
1125676314 15:41504204-41504226 TCACTCCTGCCAATGGAGCTGGG - Exonic
1127665684 15:61144461-61144483 TGGGTCCTACAGAGGGATCTGGG + Intronic
1128500427 15:68223422-68223444 TGGCTACTGAGGAAGGAGCTGGG - Intronic
1129159878 15:73741254-73741276 AGGCTCCGGGAGATGGAGATGGG - Intronic
1129356580 15:74995914-74995936 TGGCTCCCGCAGAGGGAACTGGG + Intronic
1129707435 15:77802784-77802806 TGGCAGCTGCAGATGGAACATGG - Intronic
1130531151 15:84748593-84748615 TGGCTCCCGCAGCCGGCGCTGGG + Intergenic
1132663940 16:1073208-1073230 TGGCTCCTGGAGCTGGAGGAGGG + Intergenic
1133390546 16:5406750-5406772 TGGGTCCTGCAGGAGGGGCTGGG + Intergenic
1133574880 16:7079109-7079131 TGGCTCCTGCTGATTGAGAATGG - Intronic
1133738103 16:8630941-8630963 TGGCTTGTGAAGATGGAGCTGGG - Intronic
1134008169 16:10832329-10832351 TAGCGCCTGCAGAGGGAGCAGGG - Intergenic
1135154602 16:20041611-20041633 TAGCTTCTGCAGAAGGTGCTGGG + Intronic
1135329037 16:21545887-21545909 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1136339383 16:29631864-29631886 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1137739860 16:50758317-50758339 TGGCTGCGGCAGATGGAGTGAGG + Intronic
1139263496 16:65618202-65618224 TGGGGGCTGCAGATGGATCTTGG - Intergenic
1139347240 16:66311849-66311871 TGGCTCCTGGGGATGGAGGGTGG - Intergenic
1141624109 16:85252500-85252522 TGGCGCCTGCAGATGGGCTTGGG - Intergenic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1142605862 17:1080720-1080742 AAACTCCTGGAGATGGAGCTTGG + Intronic
1142737295 17:1908901-1908923 TTTCTCCAGCAGGTGGAGCTGGG + Intergenic
1143188953 17:5027555-5027577 TGGCTCCTGAAGACTGAGGTTGG + Exonic
1143259693 17:5588827-5588849 TGGCTACTTCAAATGGAGCAGGG + Intronic
1143280775 17:5752622-5752644 GGGCCCCTGCAGATGGATCTAGG - Intergenic
1144993101 17:19247586-19247608 TGGCTCCTGCAGCTGGTGACGGG + Intronic
1146923039 17:36726583-36726605 TGGCTCCAGCCGATGGAGCCTGG + Intergenic
1147031748 17:37643510-37643532 TGGCTCCTGTAGGCGGAGCCTGG + Intergenic
1148491548 17:48026709-48026731 TGGCTCCTGCATCTGCAGCGTGG + Intronic
1149614839 17:57988505-57988527 TGGCTCAGGCAGCTGGAGCAGGG + Intergenic
1151228529 17:72664880-72664902 TGGCTGGTGTAGCTGGAGCTAGG - Intronic
1151516388 17:74598925-74598947 AGGCTCCTGCAGATGCAGGGTGG + Intergenic
1151810750 17:76439868-76439890 TGTGTCCTGCAGGTGGAACTAGG + Intronic
1151887811 17:76933414-76933436 TGGCTCCTGTGGATGGACCAAGG + Intronic
1151919822 17:77145839-77145861 AGGCTCCAGCACATGGAGCCAGG - Intronic
1152288929 17:79427935-79427957 TGCTCCCAGCAGATGGAGCTGGG + Intronic
1152417988 17:80175517-80175539 TGGCTCCTGCAGAGGCGTCTGGG - Intronic
1154216761 18:12421152-12421174 AGGCCCCTGCAGCAGGAGCTGGG - Intronic
1155259410 18:24026778-24026800 TGGCTGCTGCAGATGGAAGGAGG - Intronic
1155784273 18:29877516-29877538 TGGCTACTTCAAATGGAGCAGGG - Intergenic
1157191474 18:45585775-45585797 TGGCTCATGCAGAGGGAGAAGGG - Intronic
1157525942 18:48382264-48382286 TAGCTTCTGAAGATGGAGATAGG + Intronic
1157621845 18:49021359-49021381 TGCGTGCTGCAGATGGAGGTGGG - Intergenic
1158617154 18:58998654-58998676 AGGCTCCTACAGATGGAACAAGG - Intergenic
1160008663 18:75087854-75087876 TGGCTACTGGAGGTGGAGCGCGG + Intergenic
1160036857 18:75309750-75309772 TAGATCCTGCAGAGGGAGCACGG - Intergenic
1160473848 18:79165677-79165699 AGCTTCCTGCACATGGAGCTGGG - Intronic
1160796028 19:945794-945816 CGGCTCCTGCTGCTGGTGCTGGG + Intronic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161766793 19:6212852-6212874 GGGCTCCTGGCGATGGAGCGGGG + Intergenic
1162889588 19:13722814-13722836 TGTCTCCTGCAGATGCAGAGAGG - Intergenic
1163061687 19:14766064-14766086 AGGGTCCTGCGGAAGGAGCTGGG - Intronic
1163265883 19:16221443-16221465 TGGCTCCAGCCAATGGAGATAGG - Intronic
1163324121 19:16592263-16592285 CCCCTCCTGCAGATGGAACTTGG - Intronic
1164482156 19:28620095-28620117 GGGCAGCTGCAGAGGGAGCTAGG + Intergenic
1165061541 19:33207394-33207416 CAGCTCCTGCAGATGCACCTCGG + Exonic
1166366085 19:42279245-42279267 TGGCTTCTGCTGGTGGAGATAGG - Intronic
1166651296 19:44577117-44577139 TAGAACCTGCAGAGGGAGCTCGG + Intergenic
1166855795 19:45782153-45782175 GGGCTCCTGCAGATGGGGTGGGG - Intronic
1167706613 19:51084704-51084726 TGGCTCTTTGAGCTGGAGCTTGG + Intergenic
927521121 2:23698938-23698960 GAGCTCCTGCAGAAGGAGCTGGG - Intronic
927690120 2:25202279-25202301 TGGCTCCTGCTCATTGGGCTTGG - Intergenic
927846177 2:26473888-26473910 TGGCTCCTGGTGATGGTGGTGGG + Intronic
927861234 2:26561561-26561583 GGACTGCTGCAGAGGGAGCTGGG + Intergenic
928101014 2:28437416-28437438 TGGATCCTGCAGAAGGGGCCAGG - Intergenic
930006529 2:46901734-46901756 TGACTCCTGCAAAAGGAGCAGGG + Intergenic
930167334 2:48215795-48215817 TGGATCCTTCAGAGGGAGCATGG + Intergenic
930751227 2:54936329-54936351 TGGCTCCACCAGATGTAACTAGG - Intronic
933786524 2:85847226-85847248 TGGCTTCTGGAGAAGGGGCTTGG - Intronic
935217081 2:100982849-100982871 TGGAGACTGCAGAGGGAGCTGGG + Intronic
935678475 2:105616735-105616757 TGGCTGCTGCAGCTGGACTTTGG + Intergenic
936350274 2:111707121-111707143 TGGCTCCTACACATGGGGTTTGG - Intergenic
938295210 2:130173735-130173757 TGGCTTCCTCAGAGGGAGCTGGG - Intronic
938593999 2:132768006-132768028 TGGCTCCTGCAGAAGAGACTAGG + Intronic
938761372 2:134429324-134429346 TGGGTGCTGCTGTTGGAGCTGGG + Intronic
940254518 2:151714638-151714660 TGGCCCCAACAGATGGATCTGGG + Intronic
940295255 2:152116136-152116158 TAGATCCTGCAGAGGGAGCATGG - Intergenic
941019353 2:160391358-160391380 TGGCACCTTCAGAGGGAGCATGG + Intronic
941748381 2:169110779-169110801 TGGCTCCAGCACAAGGAGGTCGG - Intergenic
944796892 2:203196216-203196238 CTGCACCTGCAGATGGAACTTGG - Intronic
945164080 2:206923667-206923689 TGGCTGCTGAACTTGGAGCTGGG - Intergenic
946372757 2:219290606-219290628 TCACTCCTGGAGATGGAGGTGGG + Exonic
947364315 2:229378483-229378505 TGGCTACTGCAGAGGCAGCAAGG + Intronic
949063710 2:241976331-241976353 TGGCTGCTGCAGGTGGACCATGG - Intergenic
1168967546 20:1907961-1907983 GGGCTCCAGCAGATGGTTCTGGG + Intronic
1169461768 20:5801690-5801712 TGGCTCCTGAAGATATAGCAGGG + Intronic
1169586490 20:7091505-7091527 TGGATCCTCCAGATGGAGTGAGG - Intergenic
1171184138 20:23112743-23112765 TGGTTCCTGCAGGTGGAGTTTGG + Intergenic
1171981407 20:31631871-31631893 TGGCTCCTGCACATGGGCATGGG - Intergenic
1172222276 20:33282098-33282120 TGTCTGCTGCAGATGGAGACAGG + Intronic
1172614231 20:36272974-36272996 TGGCTCCTTCAGGTGGGGGTTGG + Intergenic
1172671178 20:36635407-36635429 TGTGCCCTTCAGATGGAGCTGGG + Intronic
1173801050 20:45894773-45894795 TGGAGCCTCCAGATGGGGCTGGG - Intronic
1174837601 20:53873074-53873096 TGACTCCAGCAGATGGAACAAGG - Intergenic
1175354723 20:58355309-58355331 TGGCCCCAGCTGATGGAGCTGGG - Intronic
1175682170 20:60996950-60996972 TGCCTGCTGCGGATGGAGCCAGG - Intergenic
1175690512 20:61062464-61062486 TGGCTGCTACAGATTGAGGTGGG - Intergenic
1175910587 20:62403519-62403541 TGGAGCCTGCAGAGGGAGCGTGG + Intronic
1175955235 20:62605668-62605690 TGGCTGATGGAGAGGGAGCTGGG + Intergenic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1179820377 21:43933790-43933812 TGGCTCTTGCAGCTGGTGCTTGG - Intronic
1180183497 21:46128378-46128400 TGGCTCCAGGAGATGCAGCAGGG + Intronic
1180514964 22:16132127-16132149 TGCCACCTGCAGGTGGTGCTGGG + Intergenic
1181730506 22:24843001-24843023 TGGCTCCTGCTGCTGTACCTTGG - Intronic
1181970847 22:26688705-26688727 TGTCTCCAGAAGCTGGAGCTGGG - Intergenic
1181990720 22:26834817-26834839 TGGCTCCAACAGGTGGAGGTAGG - Intergenic
1182632248 22:31695652-31695674 AGGCTGCTGCAGACGGAGGTAGG - Intronic
1183441743 22:37826938-37826960 TGGCTCCTGCAGCTGAGGCAGGG + Intergenic
1184022122 22:41827806-41827828 TGGTGCCAGCAGCTGGAGCTGGG + Intergenic
1184243722 22:43225155-43225177 TGGCTGGTGAAGATGGAGCTGGG - Intronic
1184451528 22:44585630-44585652 TGGCTCCTGCTGCTGGAGCATGG - Intergenic
1184507583 22:44913770-44913792 TGGCACCTGCAGACTGAGCAGGG + Intronic
1184509771 22:44926585-44926607 TTGCTCCTGCAGATAGCTCTGGG + Intronic
1184554953 22:45228046-45228068 AGGGACCTGCAGATAGAGCTGGG + Intronic
1184743848 22:46444766-46444788 TGGAGCCTCCAGAGGGAGCTGGG - Intronic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
1185365935 22:50436772-50436794 TGCCCCCTGCACATGGAGGTCGG + Intronic
950332137 3:12164611-12164633 TGCCTACTGCAGATGGAGGCAGG - Intronic
950409684 3:12827428-12827450 TCCCTCCTGCAGGTGGAGATGGG + Exonic
950432229 3:12957534-12957556 AGGCTCCAGCAGAGAGAGCTAGG + Intronic
951910618 3:27746805-27746827 TGGCTCTTCTAGATGGATCTTGG - Intergenic
953902353 3:46850424-46850446 TGGGGCCTGCAGCTGGAGGTGGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
958101210 3:89013402-89013424 TGTCTCCTGCAGAGAGAGCAGGG + Intergenic
958812692 3:98879966-98879988 TGTCTCCTGCAGATGCAGTAGGG - Intronic
959225885 3:103583881-103583903 TGGCTCCTGCAGTGAGACCTGGG - Intergenic
960006341 3:112784984-112785006 TGGCCCGTGGTGATGGAGCTGGG + Intronic
960199603 3:114814844-114814866 TTGCTCAAGCAGATGCAGCTTGG - Intronic
961403464 3:126663254-126663276 TGCCTCCCCCAGATGGAGCCAGG - Intergenic
961797249 3:129418383-129418405 GGGCTCGGGCAGCTGGAGCTGGG + Exonic
964818736 3:160746235-160746257 TGGCTAGTGCAAATGGAGATGGG + Intergenic
967266906 3:187699202-187699224 TGGCTCCTGAGGATGCTGCTCGG - Intronic
967922110 3:194621283-194621305 TGGCGCCTGCAGAGGGAGCATGG + Intronic
968735213 4:2291698-2291720 GGGCTCCAGGAGAAGGAGCTGGG - Intronic
968750012 4:2383872-2383894 TGGCTCCTGGAGATGGCTCCTGG - Intronic
969113205 4:4856278-4856300 TGGCCCCAGCAGATAAAGCTCGG - Intergenic
969478261 4:7433402-7433424 TGGCTCCTGCACCAGAAGCTTGG + Exonic
969697242 4:8741715-8741737 TGGAGCCTGCAGAGGGAGCACGG + Intergenic
970758565 4:19455585-19455607 GGGGTCCTGCAGCTGGAGCTGGG - Intergenic
971317762 4:25581506-25581528 TGGCATCTGAAGATGGAGATTGG + Intergenic
972769736 4:42186093-42186115 TGGCACCTTCAGAGGGAACTTGG + Intergenic
973253541 4:48085657-48085679 TGTCACCTGCCAATGGAGCTTGG - Intronic
976257061 4:83110052-83110074 TGGCGCCTGCCGCTGGGGCTGGG - Intronic
982348407 4:154386652-154386674 TGGCTGCTGGAGATGCAGCAGGG - Intronic
982873504 4:160614163-160614185 TGGCACCTACAGAGGGAGCAAGG + Intergenic
983862629 4:172726443-172726465 TGGCTCCTGCAAGGAGAGCTTGG + Intronic
984590037 4:181606883-181606905 TGGCTCCCGCAAATGGCCCTGGG - Intergenic
984705044 4:182841460-182841482 TTGCTCCTCCAGAGGGAGCAGGG + Intergenic
985874724 5:2585983-2586005 TGGGTGCTGGAGATGCAGCTGGG + Intergenic
990700369 5:58468502-58468524 TGACTCTTGCAGATTGAGTTAGG - Intergenic
990887341 5:60609573-60609595 TGTCACCTGCAGCTGGAGCATGG + Intronic
991409651 5:66333451-66333473 TGGCTCCAGCAGCTGGTGCGAGG - Intergenic
992566166 5:77997233-77997255 TGGATCCTGCAGATGATGCGTGG - Intergenic
998169636 5:139864905-139864927 TGGCTGCTGCAGAGAGAACTTGG + Intronic
998372851 5:141672357-141672379 TGGCTCCTGCAGGAAGAGCCAGG - Intronic
999719320 5:154386927-154386949 TAGCTCCTGATGATGGAGCTGGG - Intronic
1000345099 5:160307775-160307797 GGGCTTCTGCAGATGCAGCAGGG + Intronic
1002284507 5:178153376-178153398 TGGCTTCTGTATATGGGGCTAGG + Intronic
1002315560 5:178341057-178341079 TGGCTCCTGATGGTGGAGCAGGG + Intronic
1002369269 5:178737987-178738009 TGGCTCCAGGTGATGGAGCAGGG - Intergenic
1002369405 5:178739159-178739181 TGGCTCCAGGTGATGGAGCAGGG + Intergenic
1005335881 6:24795815-24795837 GGGCTGCTGCAGGTGGAGGTAGG + Intergenic
1005741485 6:28794987-28795009 TGGCTTCTGCAGATGGAGAGAGG + Intergenic
1005743108 6:28811078-28811100 TGGCTCCTGCAGATGGATAGAGG + Intergenic
1006181929 6:32158864-32158886 TGGCTAGTGCACAAGGAGCTGGG + Intronic
1006397543 6:33796992-33797014 GGGCTCCTGAGGAGGGAGCTGGG - Intronic
1006744275 6:36330486-36330508 GAGCCTCTGCAGATGGAGCTGGG + Exonic
1007693040 6:43715079-43715101 GGGCCCCTGCAGGTGCAGCTTGG - Intergenic
1008079472 6:47179290-47179312 TGGCCTGTGCAGATGGATCTTGG - Intergenic
1008726446 6:54427235-54427257 TGACTCCTGCTGAGGGAGCCTGG + Intergenic
1012704631 6:102506167-102506189 TGGCTCCTTGTCATGGAGCTAGG + Intergenic
1015879321 6:137855551-137855573 TGGCTCCTGCAGAAAGAGACTGG + Intergenic
1018231682 6:161681918-161681940 GGGCTCCTGCAGATAGACCAGGG + Intronic
1018639841 6:165896038-165896060 TTGCTTCTGCAGTTGAAGCTGGG - Intronic
1019350390 7:551640-551662 TGGCTCCAGGAGAAGGACCTGGG - Intronic
1019605525 7:1908166-1908188 AGGCTGCTGCAGCTGGAACTGGG + Intronic
1019770439 7:2880923-2880945 TGGCTCCGGCTGGTGGGGCTGGG - Intergenic
1020140226 7:5607736-5607758 TGGCTGCTGCAGAGGGAAGTCGG + Intergenic
1020218850 7:6218406-6218428 TCTCTCCTCCAGATGGAGCACGG + Intronic
1024054767 7:45652920-45652942 GGGCTCCTGCAGATGGCCCTGGG + Intronic
1024397800 7:48889258-48889280 TGGCTCCTTCATATGGTGTTGGG - Intergenic
1026209097 7:68287482-68287504 TGGCTGCTGCAGCTGGAGGTGGG + Intergenic
1029176132 7:98665843-98665865 TGGGTGCTGCAGATGCAGCAGGG - Intergenic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1034098930 7:148435502-148435524 CGGCTCCTGCAGAGGGAGGGAGG - Intergenic
1034405943 7:150902538-150902560 TGGCTCCTGGGGATGGGGGTGGG - Intergenic
1034969905 7:155412493-155412515 TGGCTCTTCCACATGCAGCTGGG - Intergenic
1035808362 8:2471879-2471901 TGGCTCCTCCTCCTGGAGCTGGG + Intergenic
1035999630 8:4586490-4586512 TGGCTCATCCAGAAGGAACTAGG - Intronic
1037630433 8:20650816-20650838 TGGCTTTTGCACCTGGAGCTGGG + Intergenic
1037753695 8:21698293-21698315 TGGCCCTTGCAGATGGCACTGGG + Intronic
1038753218 8:30316173-30316195 ATGCTCCTGCTGTTGGAGCTGGG - Intergenic
1042931153 8:74015355-74015377 TAGCTCCTACAGAGGGAGCATGG - Intronic
1045302205 8:100921439-100921461 TGGCCCATGCTGAAGGAGCTAGG + Intronic
1045506396 8:102781755-102781777 TGGCTCCTGCAGAAGCAGATGGG - Intergenic
1047372417 8:124266959-124266981 TTGCTCCTGCAGATGAAGACTGG - Intergenic
1051083760 9:13323281-13323303 TGGCTGCTGCCCAAGGAGCTCGG + Intergenic
1053133042 9:35629586-35629608 TTGCTTCTGCTGCTGGAGCTCGG + Intronic
1056926110 9:90835712-90835734 TGGCTGCTTCAGATGGAGCTTGG - Intronic
1057949202 9:99356475-99356497 TGGCTCATGCTCGTGGAGCTGGG + Intergenic
1059086399 9:111307454-111307476 TGGTTCATGGAGATGGTGCTGGG - Intergenic
1060676617 9:125520965-125520987 TGGCTACTGAAGATGGACCTGGG - Intronic
1061485264 9:130917395-130917417 ATGGTCCTGCAGATGGTGCTGGG + Intronic
1061583551 9:131552634-131552656 TGTCTCCTGCACATGCAGTTTGG + Intergenic
1061768491 9:132898797-132898819 TTGCTCCTGAACCTGGAGCTAGG - Intronic
1061980550 9:134100859-134100881 TGGCTCCTGCCAATGGAGACAGG - Intergenic
1062125596 9:134859854-134859876 TGGCTCCTGCCAATGGAGACAGG + Intergenic
1062496454 9:136833683-136833705 AGGCTGCTGCAGCTGCAGCTGGG - Intronic
1189295247 X:39913231-39913253 AGATTCCTGAAGATGGAGCTTGG + Intergenic
1189446783 X:41086673-41086695 GGGCTCCTGGAGTGGGAGCTGGG + Intronic
1200084277 X:153595724-153595746 GGGCTTCAGCAGAGGGAGCTTGG - Intronic