ID: 1069726096

View in Genome Browser
Species Human (GRCh38)
Location 10:70580022-70580044
Sequence ACTTAAGCACAAAAGGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069726096_1069726102 -10 Left 1069726096 10:70580022-70580044 CCCAGATCCTTTTGTGCTTAAGT No data
Right 1069726102 10:70580035-70580057 GTGCTTAAGTGAGCTGGGTTGGG No data
1069726096_1069726103 8 Left 1069726096 10:70580022-70580044 CCCAGATCCTTTTGTGCTTAAGT No data
Right 1069726103 10:70580053-70580075 TTGGGTTTTCTGTCATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069726096 Original CRISPR ACTTAAGCACAAAAGGATCT GGG (reversed) Intergenic
No off target data available for this crispr