ID: 1069726432

View in Genome Browser
Species Human (GRCh38)
Location 10:70583108-70583130
Sequence TTAGATGTACCCACCTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069726432_1069726440 16 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726440 10:70583147-70583169 GGGTCCATGGAACTCCTGTGCGG No data
1069726432_1069726445 22 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726445 10:70583153-70583175 ATGGAACTCCTGTGCGGGGAGGG No data
1069726432_1069726434 -9 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726434 10:70583122-70583144 TACATCTAAGTCCTAGGTGCTGG No data
1069726432_1069726442 18 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726442 10:70583149-70583171 GTCCATGGAACTCCTGTGCGGGG No data
1069726432_1069726444 21 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726444 10:70583152-70583174 CATGGAACTCCTGTGCGGGGAGG No data
1069726432_1069726447 30 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726447 10:70583161-70583183 CCTGTGCGGGGAGGGTGCCGTGG No data
1069726432_1069726441 17 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG No data
1069726432_1069726439 3 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726439 10:70583134-70583156 CTAGGTGCTGGAGGGGTCCATGG No data
1069726432_1069726436 -5 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726436 10:70583126-70583148 TCTAAGTCCTAGGTGCTGGAGGG No data
1069726432_1069726435 -6 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726435 10:70583125-70583147 ATCTAAGTCCTAGGTGCTGGAGG No data
1069726432_1069726437 -4 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726437 10:70583127-70583149 CTAAGTCCTAGGTGCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069726432 Original CRISPR TTAGATGTACCCACCTACCC AGG (reversed) Intergenic
No off target data available for this crispr