ID: 1069726438

View in Genome Browser
Species Human (GRCh38)
Location 10:70583133-70583155
Sequence CATGGACCCCTCCAGCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069726438_1069726447 5 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726447 10:70583161-70583183 CCTGTGCGGGGAGGGTGCCGTGG No data
1069726438_1069726441 -8 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG No data
1069726438_1069726448 14 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726448 10:70583170-70583192 GGAGGGTGCCGTGGAGTTCCTGG No data
1069726438_1069726455 28 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726455 10:70583184-70583206 AGTTCCTGGGGGGAAGGCTGTGG No data
1069726438_1069726440 -9 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726440 10:70583147-70583169 GGGTCCATGGAACTCCTGTGCGG No data
1069726438_1069726452 18 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726452 10:70583174-70583196 GGTGCCGTGGAGTTCCTGGGGGG No data
1069726438_1069726444 -4 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726444 10:70583152-70583174 CATGGAACTCCTGTGCGGGGAGG No data
1069726438_1069726445 -3 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726445 10:70583153-70583175 ATGGAACTCCTGTGCGGGGAGGG No data
1069726438_1069726449 15 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726449 10:70583171-70583193 GAGGGTGCCGTGGAGTTCCTGGG No data
1069726438_1069726442 -7 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726442 10:70583149-70583171 GTCCATGGAACTCCTGTGCGGGG No data
1069726438_1069726450 16 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726450 10:70583172-70583194 AGGGTGCCGTGGAGTTCCTGGGG No data
1069726438_1069726451 17 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726451 10:70583173-70583195 GGGTGCCGTGGAGTTCCTGGGGG No data
1069726438_1069726454 22 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726454 10:70583178-70583200 CCGTGGAGTTCCTGGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069726438 Original CRISPR CATGGACCCCTCCAGCACCT AGG (reversed) Intergenic
No off target data available for this crispr