ID: 1069726441

View in Genome Browser
Species Human (GRCh38)
Location 10:70583148-70583170
Sequence GGTCCATGGAACTCCTGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069726438_1069726441 -8 Left 1069726438 10:70583133-70583155 CCTAGGTGCTGGAGGGGTCCATG No data
Right 1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG No data
1069726431_1069726441 18 Left 1069726431 10:70583107-70583129 CCCTGGGTAGGTGGGTACATCTA No data
Right 1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG No data
1069726432_1069726441 17 Left 1069726432 10:70583108-70583130 CCTGGGTAGGTGGGTACATCTAA No data
Right 1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069726441 Original CRISPR GGTCCATGGAACTCCTGTGC GGG Intergenic
No off target data available for this crispr