ID: 1069729760

View in Genome Browser
Species Human (GRCh38)
Location 10:70602946-70602968
Sequence CAGGGCACACAGGCGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069729750_1069729760 6 Left 1069729750 10:70602917-70602939 CCGAGTAGAGCTGCTGGGGCTCG 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG 0: 1
1: 0
2: 1
3: 44
4: 478
1069729746_1069729760 21 Left 1069729746 10:70602902-70602924 CCAGAGGCTCATCTGCCGAGTAG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG 0: 1
1: 0
2: 1
3: 44
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069729760 Original CRISPR CAGGGCACACAGGCGGAGGA GGG Intergenic
900165253 1:1241918-1241940 CGGGGCACCCAGGTGGAGCAGGG - Intergenic
900282628 1:1880961-1880983 CAGAGCACACCCTCGGAGGAAGG + Intronic
900302039 1:1982684-1982706 CCGGGCCCACAGGAGGAGGGCGG + Intronic
900403628 1:2483018-2483040 GAGCCCACACAGGCTGAGGACGG - Intronic
900877054 1:5350322-5350344 CTGGGCACACAGGCCAAGGGAGG + Intergenic
901376201 1:8841275-8841297 CAGGGCCCTCAGGCAGAGGCTGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902232441 1:15036414-15036436 CAGGCCAAACAGGCAGGGGAAGG - Intronic
903415182 1:23177626-23177648 CATGGCTCACTGGCGCAGGAGGG - Exonic
903543238 1:24108412-24108434 CAGGGCCCCCAGTCTGAGGAGGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904032864 1:27544041-27544063 CAGAGCACCCAGGCTCAGGAGGG + Intronic
904885963 1:33738680-33738702 CAGGGCACAAAGGCCGAGACTGG + Intronic
905017026 1:34784977-34784999 CAGGGCCCAGAGGCGGATGTTGG - Exonic
905189703 1:36224206-36224228 CAGGCCACCCAGGCGGGGGGAGG + Intergenic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
906822544 1:48944648-48944670 CAGAAAACACAGGCTGAGGAAGG - Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907481653 1:54749054-54749076 TAGGGAACACAAGAGGAGGAAGG - Intergenic
907646089 1:56244994-56245016 CAGGGCAATCAGGCGGGAGAGGG - Intergenic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
907968269 1:59354990-59355012 CAAGGCACAGAGGCGTAGGAGGG + Intronic
909723720 1:78809165-78809187 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
910270011 1:85384427-85384449 CAGGCCACAGAGGTGGAGGAGGG - Intronic
910628082 1:89329582-89329604 CAGGGCACTCAGGCAGGAGAAGG + Intergenic
911164396 1:94712096-94712118 CAGGCCACACAGCGGGAGGTGGG + Intergenic
912911805 1:113768579-113768601 TATGGCACACAGGGAGAGGAAGG - Intronic
915004380 1:152623052-152623074 CAGGGCACTTGGGCGGAGGCTGG + Exonic
915054395 1:153112676-153112698 CGGGGCACACAGGAGGTGGCTGG + Exonic
915554389 1:156653263-156653285 GACGGCACACAGGCGGATGAAGG - Intronic
915583492 1:156830433-156830455 CTGGGCACAAGGGTGGAGGAGGG - Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915809341 1:158890113-158890135 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
918026989 1:180760261-180760283 CAGGGCAAACAGGCAGGAGAAGG + Intronic
918097204 1:181345349-181345371 CAGGAAACACTGGCGGATGAAGG + Intergenic
918817792 1:189211529-189211551 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
919250868 1:195054565-195054587 CAGGCCACACAGGAGGGGGTGGG - Intergenic
920500033 1:206480131-206480153 CTGGGCACAGAGGGGGAGGCGGG + Intronic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
922160626 1:223077197-223077219 CAGGGCACACAGCCTGATGGTGG - Intergenic
922374008 1:224942498-224942520 CAGGGCAATCAGGCAGAAGAAGG - Intronic
922387642 1:225103884-225103906 CAGGGCAATCAGGCAGGGGAAGG - Intronic
922572018 1:226639927-226639949 AAGGGCATCCAGGCTGAGGATGG + Intronic
922913702 1:229238871-229238893 CAGGGCGCTCGGGAGGAGGAAGG - Intergenic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
922991839 1:229920856-229920878 CAGGGCCCACAGGCCTGGGATGG + Intergenic
924859832 1:247909862-247909884 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063395703 10:5685182-5685204 CCGGGCGCCCAGGCCGAGGAGGG - Intronic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1063840105 10:10061876-10061898 CAGGGAACCCAGGCTGATGAAGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064921820 10:20527707-20527729 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1065418623 10:25517365-25517387 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1068647270 10:59481443-59481465 AAGGGAACACTGGCGGAAGAAGG + Intergenic
1068952291 10:62789697-62789719 CAGGACACACAGGAGCTGGAAGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1069996052 10:72342837-72342859 CAGGGCCCACTGGCTCAGGATGG - Intronic
1070354525 10:75626759-75626781 CAGGCCATACAGGCAGAAGATGG - Intronic
1071074966 10:81739049-81739071 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
1074179608 10:111047271-111047293 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1074296436 10:112193493-112193515 AAGGGCAAACAGGCAGATGATGG + Intronic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532324 10:114305906-114305928 GAGGGGACACAGGTGCAGGAGGG + Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075491161 10:122870933-122870955 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1075574824 10:123570738-123570760 CAGGCCACAAAGGCGGGAGAGGG - Intergenic
1075787581 10:125060645-125060667 CAGGGCAGTCATGCGGAAGAGGG + Intronic
1076070277 10:127483199-127483221 AAGGGCACAGAGGCAGGGGAGGG - Intergenic
1076266048 10:129110651-129110673 CAGGACACAAAAGCGGAGCAGGG + Intergenic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1077012185 11:384235-384257 CCGAGGACACAGGCGGGGGAGGG + Intergenic
1077697006 11:4402800-4402822 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078643274 11:13115499-13115521 CAGGTCACAGAGCCAGAGGAGGG + Intergenic
1080291662 11:30677931-30677953 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1080378738 11:31744887-31744909 CAGGGCACTCAGGCAGGGGAAGG + Intronic
1081405421 11:42692146-42692168 CAGGGCAAACAGGCAGCAGAAGG + Intergenic
1081577795 11:44330045-44330067 CAGGGACCACAGGCTGAGGCTGG + Intergenic
1081940400 11:46936710-46936732 CATGGCACCCACGCGGCGGAAGG - Intronic
1082072656 11:47951418-47951440 CAGGTGTCACAGGCAGAGGAAGG - Intergenic
1082135441 11:48543899-48543921 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1083771821 11:64871786-64871808 GAGGCCACACAGGCAGAGCAGGG + Intronic
1084275759 11:68050216-68050238 CAGGGCCCACAGGCGCAGGTAGG - Exonic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1085777951 11:79383061-79383083 CAGGGCAGAAAGGCAGAAGATGG - Intronic
1086921735 11:92595302-92595324 GAGGACACACAGGCTGGGGAGGG - Intronic
1089139677 11:116275696-116275718 GAGGGCACACAGGCAGGTGAGGG + Intergenic
1089319023 11:117612641-117612663 CAGGGCTCACTGGCTGGGGAGGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089688633 11:120172484-120172506 CAGGCCACACAGGAGCAGGAGGG - Intronic
1089846725 11:121464615-121464637 CAGGGCACGCAGGGGGCTGAGGG + Intronic
1090076673 11:123584222-123584244 AAGGGCACACAGACAGCGGAGGG - Intronic
1090265502 11:125350818-125350840 CAGCGCGCACAGGGGCAGGAGGG - Intronic
1090372962 11:126269336-126269358 AAGGACACACAGTCGGAGGTTGG - Intronic
1090770052 11:129912077-129912099 CAGGGTACCTGGGCGGAGGACGG + Exonic
1091077058 11:132629066-132629088 CAGGGCAAGCAGGCTTAGGATGG - Intronic
1091260597 11:134231156-134231178 AAGGTCAGACATGCGGAGGAGGG + Intronic
1091407866 12:220363-220385 CACAGCACAAAGGCGGAGGAAGG + Intergenic
1091795077 12:3293518-3293540 CAGGGCACATAGGAGGTGGTGGG + Intergenic
1092106864 12:5927529-5927551 CAGGGCACAGAAGCTGGGGAGGG - Intronic
1095629177 12:44354286-44354308 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1096463558 12:51836217-51836239 CAGGGCAGACAGGCGGGGCTGGG - Intergenic
1096601217 12:52731064-52731086 TAGGGAACACAGGGAGAGGATGG + Intergenic
1096782097 12:53997462-53997484 CTGGACACAAAGGCGGAAGAGGG - Intronic
1096811441 12:54172933-54172955 ACGGGCACACAGGTGGAGAAAGG + Intronic
1098372504 12:69775406-69775428 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1102068053 12:109995761-109995783 CAGGACACCCAGGCGGAGAAAGG + Intronic
1102519680 12:113470686-113470708 CAGGGCCCACAGGGGTAGGGGGG + Intronic
1103425656 12:120831041-120831063 CAGAACAAAAAGGCGGAGGAAGG + Intronic
1103430390 12:120879951-120879973 CAGGGAACAGAGGTGGAGTATGG - Intronic
1103696646 12:122820984-122821006 CAGGCCACACAGGCAGGGGGAGG + Intronic
1103797018 12:123510184-123510206 CAGGACCCACAGCCGGAGGCAGG - Intronic
1104397518 12:128447178-128447200 AAGTGGACACAGGCGCAGGAGGG - Intronic
1104462938 12:128969963-128969985 AAGCGCACACAGGCAGAGGCAGG - Intronic
1104690081 12:130819048-130819070 CAGGGCAGAGAGGTGGACGAAGG - Intronic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105779014 13:23690241-23690263 CAGTGCACCCGGGCGGAGGGAGG + Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1108022096 13:46137992-46138014 CAGGTCAAACAGGCTGTGGATGG - Intronic
1109020686 13:57087997-57088019 CAGAGCACAGAGGCTGAGGTTGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110123006 13:71906523-71906545 CAGGGAACACAGGCAGAGGGTGG + Intergenic
1110884847 13:80619819-80619841 AAGGACACACAGGTGGATGAAGG - Intergenic
1111780395 13:92716358-92716380 CAAGGCAAACAAGCAGAGGAAGG - Intronic
1112374214 13:98823908-98823930 CACAGCACACAAGCGGAGGCAGG + Intronic
1113489807 13:110682371-110682393 CAGGGCACCACGGCGGGGGAAGG + Intronic
1113808576 13:113123827-113123849 CAGGGGACAGAGGCTGGGGAGGG - Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114655326 14:24312162-24312184 CAGGGCACCTGGGCTGAGGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117275440 14:54188623-54188645 CATGGCACACAAGGGAAGGAGGG - Intergenic
1118760099 14:68875693-68875715 CAGGGCACTCTGGCAGAGGTAGG - Intronic
1119575273 14:75715295-75715317 CAGGGCCCACATGAGGAAGATGG - Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121053869 14:90837139-90837161 CAGGCCCCACAGGAGGAGTATGG - Intergenic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1202939861 14_KI270725v1_random:136563-136585 CAGGCCACAGAGGCCGAGGCAGG + Intergenic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1126235411 15:46378001-46378023 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1127817354 15:62622947-62622969 CAGGGCACACAGACAGATGATGG - Intronic
1128562786 15:68679491-68679513 CAGAGCACAGAGGCAGAGGGAGG + Intronic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129051355 15:72784114-72784136 GAGGGGACACGGGCGGAGGGAGG - Intronic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130052512 15:80495694-80495716 CAGGGCACAGAGCCCTAGGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130811295 15:87381356-87381378 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1131052735 15:89359233-89359255 CAGGGCGCAGAGGCGCAGGCTGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132110378 15:99098437-99098459 CAGGGCACAGATGCAGATGATGG - Intronic
1132726165 16:1339210-1339232 CAGGGCTCTCAGGCCGAGGCTGG - Exonic
1132826129 16:1906563-1906585 CCGGGAGCACAGACGGAGGAGGG + Intergenic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1133062300 16:3182941-3182963 CAGGGCTGAGAGGCGGAGGCGGG - Intergenic
1133169786 16:3975062-3975084 CTGGGCACAAAGGCGGCAGAGGG + Intronic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1134385053 16:13763947-13763969 GAGGCCAAACAGGCCGAGGAAGG + Intergenic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1136114706 16:28087383-28087405 CAGAGCACACAGGCAGGGGGTGG + Intergenic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138345929 16:56320211-56320233 TTGGGCACACGGGAGGAGGATGG - Intronic
1138528023 16:57620090-57620112 CAGGCCACACAGGCACAGGCCGG + Exonic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139782824 16:69365812-69365834 CAGCGCACCCAGCCTGAGGAAGG + Intronic
1142034314 16:87854210-87854232 CAGGACAGACAGGCGGGGGCCGG + Intronic
1142053055 16:87972981-87973003 CATGGCACACGGGCATAGGATGG - Intronic
1142132229 16:88436337-88436359 CAGGGCCCACAGGCTGAGGCCGG - Exonic
1142153566 16:88523247-88523269 CAGTGCCCACAGGCAGAGCAGGG + Intronic
1142214499 16:88824013-88824035 CTGAGCACCCAGGCTGAGGAGGG - Intronic
1142338444 16:89505699-89505721 AAGAACACACAGGCGGAGAAGGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142606374 17:1083642-1083664 CAGGGAACAGAGGGAGAGGAGGG + Intronic
1142962526 17:3559545-3559567 CAGGGGACACAGGCTCAGGCAGG + Intergenic
1143620102 17:8075780-8075802 CAGGGCACCCTGGGGGAGGTGGG - Intronic
1143784649 17:9247393-9247415 CAGGCCACACAGGGTGGGGACGG - Intergenic
1144666486 17:17105589-17105611 CAGGCCACTGAGGCAGAGGAGGG + Intronic
1144702323 17:17347751-17347773 CATTGAAGACAGGCGGAGGAAGG + Intergenic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1144850120 17:18240005-18240027 CAGTTCACACAGGCAGAGCAGGG + Intronic
1145730927 17:27185024-27185046 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1146092846 17:29899276-29899298 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1146890117 17:36501450-36501472 CAGGACACACAGGCGCAAGTGGG - Intronic
1147112953 17:38277433-38277455 GTGGGATCACAGGCGGAGGAGGG - Intergenic
1147393250 17:40122573-40122595 CCGGGCACCGAGGCGGAGGAGGG - Intronic
1148416668 17:47511792-47511814 GTGGGATCACAGGCGGAGGAGGG + Intergenic
1148774799 17:50089285-50089307 AAGGGGACACTGGGGGAGGAGGG - Exonic
1148845061 17:50525043-50525065 CAGGGCACACATGAGGGGGCAGG - Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149996273 17:61407600-61407622 GAGGGCACACATGCTGGGGAAGG - Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1151158357 17:72143324-72143346 CAGGGCACACAAGCAATGGAAGG - Intergenic
1151315852 17:73322111-73322133 CAGGACACGCATGTGGAGGAGGG - Intergenic
1151890318 17:76947541-76947563 CAGGGCACACAGGATGCAGAGGG + Intronic
1152068942 17:78125757-78125779 CAGGTCGTACAGGCGGAGGCTGG + Exonic
1152330106 17:79667822-79667844 CAAGGCACAGAGGCGGATGGAGG + Intergenic
1152564617 17:81094661-81094683 CACGGTACCCAGGCAGAGGAGGG - Intronic
1152812875 17:82390647-82390669 CACGGGCCACATGCGGAGGACGG - Intronic
1153542209 18:6167825-6167847 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1155849846 18:30760049-30760071 CAGGGCACAAAGGCAGATAATGG - Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156547881 18:37983881-37983903 CAGAGCTCACAGGAGGAAGAAGG - Intergenic
1156727573 18:40148009-40148031 CAGGCCACGCAGCCGGAGGTGGG - Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157631698 18:49104406-49104428 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1157763422 18:50281314-50281336 GAGAGCGCTCAGGCGGAGGATGG - Intronic
1158604893 18:58887102-58887124 GAGGGAACACAGGCAGATGATGG + Intronic
1158630837 18:59112573-59112595 CAGGAGTCACATGCGGAGGATGG - Intergenic
1160209734 18:76866814-76866836 CAGGGCGCGCAGGGGGAGGGAGG + Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1161257044 19:3315293-3315315 CAGGGCACAGAGGCAGGCGAGGG - Intergenic
1161966339 19:7551125-7551147 CGGGGCAGAGAGGCGGAGGCGGG + Intronic
1162179063 19:8854673-8854695 CAGTGCACACAGGCATTGGAAGG + Intronic
1162782602 19:13014316-13014338 CAGGGCCCAGAGGCGGGGGAGGG - Intronic
1162926516 19:13933014-13933036 CAGGGCACGCAACCGGCGGAAGG + Exonic
1162965002 19:14151370-14151392 CAGGGGGCTCAGGCGGTGGAGGG + Exonic
1163165105 19:15491400-15491422 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1163396944 19:17069465-17069487 CTAGACACACAGGCGGGGGAAGG - Intronic
1163941097 19:20494597-20494619 CAGGGCACTCAGGCAGGAGAAGG + Intergenic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1165229815 19:34379846-34379868 CTGGGCACAAAGGCCTAGGAAGG - Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166992261 19:46699605-46699627 CAGTTCACACAGGCGCTGGAGGG - Intronic
1167207232 19:48110770-48110792 CAGGGCCTACAAGCCGAGGAGGG - Exonic
1167707972 19:51093109-51093131 GAGAGCACACAGGTGGAAGATGG + Intergenic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
925144841 2:1574324-1574346 CAGGGCAGACAGGCGGTGAAGGG + Intergenic
925191451 2:1887650-1887672 CATGGCACACAGACTGAGGGAGG + Intronic
925307463 2:2859333-2859355 CAGAGCACGCAGGCAGAGGCTGG + Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
927239395 2:20907467-20907489 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
927413871 2:22856339-22856361 TAGGCCACACAGGAGGAGGAAGG + Intergenic
927757602 2:25721791-25721813 CAGGGCACACATGTGCAGCAGGG + Intergenic
927841768 2:26449538-26449560 CACAGCACACATGCGGTGGAAGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929439651 2:41955193-41955215 CAGGGCCCAAAGGTGAAGGAGGG - Intergenic
931348801 2:61470759-61470781 GAGGGGAGAGAGGCGGAGGAGGG + Exonic
932649761 2:73542511-73542533 CAGGGCAATCAGGCAGGGGAAGG + Intronic
932839875 2:75072179-75072201 CAGGGCACAGAGGGAGAGAAGGG + Intronic
933455779 2:82517440-82517462 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
933695899 2:85216954-85216976 GCTGGGACACAGGCGGAGGAAGG - Intronic
933772448 2:85753255-85753277 CAAGTCACAGAGGCAGAGGAGGG - Intronic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936821180 2:116523416-116523438 CAGAGCACTCAGGCAAAGGAAGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937321243 2:120962007-120962029 CTGGGCACACAGGCCGTGGGGGG + Intronic
937475157 2:122208630-122208652 CAGGACTCACAGGCTGAAGAGGG - Intergenic
937989382 2:127653901-127653923 CAGGGCTCACAGACAGAGGCCGG + Intronic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
940095541 2:149969855-149969877 CAGGGCAATCAGGCAGCGGAAGG + Intergenic
940814419 2:158282275-158282297 CAGGGCAATCAGGCAGAAGAAGG + Intronic
941726782 2:168869354-168869376 CAGGGCAATCAGGCAGAAGAAGG + Intronic
942307939 2:174627134-174627156 CAGAGCACAGTGGTGGAGGATGG - Intronic
942326255 2:174779294-174779316 CATGGCACACACCTGGAGGAAGG - Intergenic
945533538 2:210985205-210985227 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947472825 2:230414059-230414081 CAGGGCACCCAGCCAGATGATGG - Intergenic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948421026 2:237859901-237859923 CAGGGCACAGGGGAGGCGGAGGG + Intronic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948888457 2:240895684-240895706 GAGGCCACCCAGCCGGAGGATGG - Exonic
1172331425 20:34078514-34078536 CAGGACACAGACGCGGATGATGG + Exonic
1172846099 20:37930771-37930793 CAGGGCACCCAGGGTGAGGTGGG - Intronic
1173403649 20:42746381-42746403 CCGGGCACCCATGAGGAGGATGG + Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175446371 20:59022992-59023014 CTGGGAACACAAGCAGAGGAAGG + Intronic
1176002553 20:62839572-62839594 CAGGGCACCCAGGCAGAGGTGGG - Intronic
1176002579 20:62839674-62839696 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002597 20:62839722-62839744 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002615 20:62839770-62839792 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176029326 20:63003897-63003919 GTGGGCACACAGGCCGTGGAGGG + Intergenic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1176583328 21:8550522-8550544 CAGGCCACAGAGGCCGAGGCAGG - Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178324601 21:31633936-31633958 CAGGTCACAAAGGCTGAGGTGGG - Intergenic
1178476307 21:32940271-32940293 CTGGGCACACAGGCAGAGTCGGG - Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178973599 21:37202809-37202831 CAGTGAACAAAGGCAGAGGAAGG - Exonic
1179766677 21:43578858-43578880 CAGGGCACTCTGGCTTAGGAGGG + Intronic
1179891204 21:44335927-44335949 CTGGGCACACTGGCTGAGTAAGG - Intronic
1179891219 21:44335979-44336001 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891235 21:44336031-44336053 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891251 21:44336083-44336105 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891267 21:44336135-44336157 CTGGGCACACTGGCTGAGCAGGG - Intronic
1180266138 22:10527452-10527474 CAGGCCACAGAGGCCGAGGCAGG - Intergenic
1181048827 22:20229113-20229135 CAGGGGACACAGGCTGGGGGAGG + Intergenic
1181057840 22:20268282-20268304 CAGGGCGCACAGGGCGAGGGCGG + Exonic
1181567892 22:23750949-23750971 CAGGTCACACCGGCGGACGCGGG + Exonic
1181851184 22:25751042-25751064 CAGGACACTCAGGCAGAGGGAGG - Intronic
1182711488 22:32325976-32325998 CAGGGCCCACGGGGTGAGGAGGG + Intergenic
1183520690 22:38294603-38294625 CAGGGCACAGAAGGGGAGGGAGG + Intronic
1183748212 22:39704351-39704373 AAGGGCACAAAGGTGGAGGAGGG + Intergenic
1184399014 22:44262765-44262787 CAGGGCCCACGGGGTGAGGAGGG + Intronic
1184512687 22:44942644-44942666 CAAGGCACACGGTCAGAGGAGGG + Intronic
1184971855 22:48028132-48028154 CAGGGCACAGAGGGAGTGGAAGG + Intergenic
1185045435 22:48526225-48526247 CACCACACACAGACGGAGGAGGG - Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185055310 22:48575999-48576021 GGGGGCCGACAGGCGGAGGAGGG + Intronic
1185265597 22:49901037-49901059 CACGGCACACAGGCAGAGCATGG + Exonic
1185294599 22:50046907-50046929 CAGGGCACAGAGGCCAAAGATGG - Intronic
950916242 3:16648086-16648108 CAGAGCAAACAGGCAGAAGAAGG - Intronic
951474343 3:23089301-23089323 CAGGGCAAACAGGCAGGAGAAGG - Intergenic
951658630 3:25037354-25037376 CAGGGCAAACATGGGGTGGAGGG + Intergenic
952546856 3:34429734-34429756 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
954987245 3:54806200-54806222 CAGGGCAATCAGGCGGGAGAAGG + Intronic
955751154 3:62186460-62186482 ATGGGCACACAGGGTGAGGAGGG + Intronic
955916511 3:63912764-63912786 CGGCGCACACGGCCGGAGGACGG + Exonic
956866105 3:73370448-73370470 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
958545920 3:95550268-95550290 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
961016172 3:123469972-123469994 CAGGGCCCACAGGGGCAGGGAGG + Intergenic
961555544 3:127694545-127694567 CAGGGCACACAGGTGCTGGCAGG - Intronic
961786464 3:129350036-129350058 CAGGGCTGACAGGCAGAGCAGGG - Intergenic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963064608 3:141253312-141253334 GAGGCCACACAGGCGGAGCTGGG - Intronic
965035556 3:163433222-163433244 CAGGGCAAACAGGCAGGAGAAGG + Intergenic
967138018 3:186528910-186528932 CAAGGCAGAGAGGCAGAGGATGG + Intergenic
967966419 3:194963725-194963747 TAGAGCACAAAGGCAGAGGAAGG + Intergenic
968581250 4:1396350-1396372 CAGGGCAGACTGGCTGAGGTTGG + Intergenic
968699397 4:2047471-2047493 CAGGAGACAGAGGCGGAGGTGGG + Intergenic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
969261352 4:6036118-6036140 CAGATCACACAGACAGAGGAAGG + Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969315739 4:6380542-6380564 CAGGTCACCCAGGCAGAGGAAGG + Intronic
969340001 4:6534745-6534767 CAGGGCAGCCATGCGGAGGCGGG - Intronic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972915233 4:43868936-43868958 CATGGCACACAAGATGAGGAAGG - Intergenic
973055732 4:45655318-45655340 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
973232999 4:47864391-47864413 CAAGACAGAAAGGCGGAGGAAGG - Intronic
974305509 4:60133502-60133524 CAGGGCACACAGTCATGGGATGG - Intergenic
975166054 4:71179352-71179374 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976918881 4:90411769-90411791 CAGGGCAATCAGGCAGGGGAAGG + Intronic
977986576 4:103389524-103389546 CAGGGCACTCAGGCAGGAGAAGG + Intergenic
978097973 4:104802909-104802931 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
978231365 4:106404445-106404467 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
978766718 4:112412158-112412180 AAGGGCACAGGGGCGGGGGAGGG - Intronic
978835616 4:113146012-113146034 TAGGCCACAAAGGAGGAGGAAGG + Intronic
979833114 4:125325908-125325930 CAGTGAACAAAGGCAGAGGATGG + Intronic
980965599 4:139517823-139517845 CAGGGCCCTGAGACGGAGGAGGG - Intronic
981605080 4:146531640-146531662 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982227569 4:153180436-153180458 CAGGGCACACAGCCTGTGAAAGG + Intronic
984725266 4:183013999-183014021 CAGTGCACTGAGACGGAGGATGG - Intergenic
984845410 4:184104045-184104067 CAGTGCGCCCAGGCTGAGGAGGG + Intronic
984935028 4:184882473-184882495 CAGGGCACAAGGGTGGAGGCCGG + Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985355370 4:189113623-189113645 AAGGGTACACATGCGTAGGAAGG - Intergenic
985875490 5:2591128-2591150 CAGGGAGCACAGGCGAGGGAGGG + Intergenic
986306927 5:6523017-6523039 CAGTCCACACAGGCTGAGGCAGG + Intergenic
987893756 5:23917939-23917961 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
990007860 5:50964073-50964095 AAGGCCCCACAGGAGGAGGAGGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990678998 5:58220037-58220059 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
991115713 5:62952299-62952321 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
991526700 5:67566807-67566829 CAGGGCACTCAGGCAGCAGAAGG - Intergenic
992815331 5:80431585-80431607 CAGGGCACTCAGGCAGGAGAAGG + Intronic
993259692 5:85642491-85642513 CAGGGCACTCAGGCAGGAGAAGG + Intergenic
994423866 5:99559737-99559759 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
997013433 5:129904734-129904756 GGGGGCGCAAAGGCGGAGGAGGG + Exonic
997337287 5:133117295-133117317 CAGGGCACACATGCTCAGGCAGG + Intergenic
998224467 5:140315795-140315817 CTGGGCACAGAGGCTGAGGTGGG + Intergenic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
998736793 5:145151249-145151271 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
999222545 5:149992717-149992739 CAAGGCACACAGGCAGAAGTCGG + Intronic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999687664 5:154117195-154117217 CAGGGGACCCATGCTGAGGAGGG + Intronic
1001321617 5:170687018-170687040 CAGGGAACTCAGGGGGAGAATGG - Intronic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001776704 5:174334284-174334306 CAGAGCACAGAGGCTGAGGCTGG + Intergenic
1001952788 5:175827864-175827886 CAGGGCACGCAGGAGGCAGATGG - Intronic
1002049313 5:176560980-176561002 TAGGGCACACTGGGGGAGGAGGG + Intronic
1002572498 5:180150713-180150735 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1002707234 5:181170101-181170123 GAGGCCACACAGGCGGACAACGG - Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1002904912 6:1440376-1440398 AAGGGGACACTGGCGGATGATGG + Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005237167 6:23778035-23778057 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1005240475 6:23819609-23819631 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1005851631 6:29827621-29827643 CAGGCCCCACAGGCGGTGTATGG + Intronic
1006294508 6:33164168-33164190 CAGGGCACCCAGGGGGAGCAGGG - Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006592557 6:35169121-35169143 CAGGCCAGACTGGCTGAGGAGGG + Intergenic
1006677735 6:35776515-35776537 CAGGCCACCCCGGCGGAGGAGGG - Intergenic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1007002577 6:38328392-38328414 CAGGCCACTCAGACAGAGGAAGG + Intronic
1007129642 6:39458519-39458541 CAGGGCACTCAGGCAGGAGAAGG + Intronic
1007137552 6:39537213-39537235 CAGGGCACTCAGGCAGGAGAAGG + Intronic
1007360425 6:41351581-41351603 GAGGGCACACAGTCCCAGGAAGG + Intergenic
1008628175 6:53337960-53337982 TTGGGCAAACTGGCGGAGGATGG + Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009517184 6:64635316-64635338 CAGGGCAATCAGGCGGGAGAAGG - Intronic
1010172583 6:72990651-72990673 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1011024711 6:82855073-82855095 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1013306221 6:108848860-108848882 GAGGACACACAGGCGGACGACGG - Intronic
1014036855 6:116776744-116776766 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1015497439 6:133895889-133895911 CTGAGCGCAAAGGCGGAGGAGGG + Intergenic
1015942308 6:138464401-138464423 CAGGGCAGGAAGGCCGAGGATGG + Intronic
1016584290 6:145666160-145666182 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1018649139 6:165976837-165976859 CATGGCGCACAGCCCGAGGAGGG - Intronic
1019095307 6:169574942-169574964 CAGGACAGAAAGGCAGAGGAGGG + Intronic
1019560455 7:1653533-1653555 CAGGGCACACAGACAGGGGCAGG - Intergenic
1019714711 7:2533277-2533299 CAGGACACACAGGAGCAGGTGGG + Intergenic
1019741608 7:2677776-2677798 CAGGACACACAGGAGCAGGTGGG - Intergenic
1020117921 7:5486852-5486874 CAGGCCACCCAGGGAGAGGACGG + Intronic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1024511524 7:50208110-50208132 CAGGGCACGAAGGGGGAGCAGGG + Intergenic
1026807625 7:73437880-73437902 CTGGGCTCACAGGCAGTGGAAGG + Intergenic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1028457883 7:91058400-91058422 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1030299533 7:107961298-107961320 CAAAGCACACCGGCCGAGGAAGG + Exonic
1030449318 7:109689121-109689143 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1032016614 7:128384108-128384130 CAGAGCACACAAGGGGAGGGAGG + Intergenic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034371445 7:150601221-150601243 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1035068391 7:156123997-156124019 CAGGACACACAGGCGGAGGCAGG + Intergenic
1035781749 8:2233343-2233365 CAGAGCACACAGGCCGGGCACGG + Intergenic
1035781765 8:2233435-2233457 CAGAGCACACAGGCCGGGCACGG + Intergenic
1035822198 8:2605500-2605522 CAGGATACACAGGCTGATGATGG + Intergenic
1037255483 8:16947980-16948002 CAGGGCAATTAGGCAGAGGAAGG + Intergenic
1037816332 8:22114668-22114690 AAGGGCAGACAGGCGGGGCAAGG + Exonic
1037913621 8:22758940-22758962 CAGTGCACACTGGCAGAGCATGG + Intronic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1038846336 8:31233257-31233279 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1039112831 8:34058913-34058935 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1039382926 8:37102791-37102813 CATGGCACATAGGCTGGGGAGGG - Intergenic
1039554953 8:38468683-38468705 CAGGGGGCGGAGGCGGAGGAGGG - Intronic
1040499525 8:47994819-47994841 TAGGCAACACAGTCGGAGGATGG - Intergenic
1040693774 8:49971512-49971534 CAGGGCAAATAGGCAGAAGAAGG + Intronic
1040725835 8:50379984-50380006 CAGAGCACACATGCTGAGGATGG + Intronic
1042720746 8:71824392-71824414 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1042790362 8:72598598-72598620 CAGGGCACTCAGGCAGGAGAAGG + Intronic
1043697017 8:83232491-83232513 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1043806797 8:84681833-84681855 CAGGGCAATCAGGCGGAAAAAGG - Intronic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1048926689 8:139278025-139278047 CAGGGCACAGATGTGGAGGCTGG + Intergenic
1049029352 8:140023010-140023032 CAGGGCCCACTGGAGGAGGAGGG + Intronic
1049168100 8:141139480-141139502 CAGGTCACAGAGGCGGACGCTGG - Intronic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049526249 8:143128152-143128174 CACGCCACACAGGTGGAGGCAGG + Intergenic
1049965501 9:775800-775822 CAGGGCACAGAAGCTCAGGATGG + Intergenic
1051790595 9:20797840-20797862 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1055099795 9:72451735-72451757 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1056192628 9:84199165-84199187 CAGGGCACACTGGTGGAAGGGGG + Intergenic
1056631664 9:88298664-88298686 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1056883755 9:90420332-90420354 GAGGGCACACAGGTAAAGGATGG + Intergenic
1057871828 9:98723719-98723741 CAGGGCACACAGGCCTGGGGGGG + Intergenic
1058146345 9:101416066-101416088 CAGGGCCCTCAGGGGGAGGGGGG - Intergenic
1059421535 9:114195505-114195527 CAGGCCACACAGGAGCAGGAGGG - Intronic
1060897301 9:127225752-127225774 CAGGGCACGCGGGCGCCGGAAGG - Intronic
1061593736 9:131615360-131615382 CACTGCACCCAGCCGGAGGAAGG + Intronic
1061880808 9:133568003-133568025 CAGGGCACGAAGGGGCAGGAAGG + Intronic
1061956135 9:133962157-133962179 CTGGGCACAGAGGGGGATGAAGG + Intronic
1062219939 9:135409708-135409730 CAGGGCGCACAGGCACAGGCCGG + Intergenic
1062721613 9:138047151-138047173 CCAGGCACACAGACAGAGGAAGG - Intronic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203375753 Un_KI270442v1:375376-375398 CAGGGCACCCAGGCCAAGGCAGG - Intergenic
1203562058 Un_KI270744v1:65511-65533 CAGGTCAGATAGGTGGAGGAGGG - Intergenic
1203613283 Un_KI270749v1:28289-28311 CAGGCCACAGAGGCCGAGGCAGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185692462 X:2167496-2167518 CAGGGCACACAGGCTGGGCGTGG - Intergenic
1186577770 X:10784973-10784995 CAGGGCAGTCAGGCAGAAGAGGG + Intronic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1188652941 X:32654144-32654166 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1190119162 X:47646401-47646423 CTGGGCACAGAGGCTGAGGTGGG - Intronic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1191092681 X:56640149-56640171 CAGGGCAAACAGGCAGGAGAAGG + Intergenic
1191573216 X:62659505-62659527 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191649699 X:63523263-63523285 CAGGGCAATCAGGCAGGGGAAGG + Intergenic
1191657142 X:63610648-63610670 CAGGGCAAACAGGCAGGAGAAGG + Intergenic
1191660732 X:63647224-63647246 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1191683179 X:63862370-63862392 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1192318231 X:70067863-70067885 CAGGGGGCACAGGCTGGGGAGGG + Intergenic
1193059361 X:77188599-77188621 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1193223585 X:78955697-78955719 CAGGGCTCACAGACTGAGGTGGG - Intronic
1195395408 X:104405219-104405241 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1198706156 X:139450693-139450715 CAGGGGACAGGGGCGGAAGATGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200885804 Y:8268242-8268264 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201258971 Y:12138995-12139017 CAGGGCAATCAGGCAGCGGAAGG + Intergenic
1201506289 Y:14704153-14704175 CAGGGCAATCAGGCAGAAGAAGG - Intronic