ID: 1069735440

View in Genome Browser
Species Human (GRCh38)
Location 10:70650881-70650903
Sequence CTGTTTGCTGGGTGGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069735430_1069735440 6 Left 1069735430 10:70650852-70650874 CCCCGATGGGTTACTTCCACCCA 0: 2
1: 0
2: 4
3: 14
4: 68
Right 1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG No data
1069735429_1069735440 12 Left 1069735429 10:70650846-70650868 CCACAACCCCGATGGGTTACTTC No data
Right 1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG No data
1069735425_1069735440 24 Left 1069735425 10:70650834-70650856 CCTCAGGTCCTGCCACAACCCCG No data
Right 1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG No data
1069735432_1069735440 4 Left 1069735432 10:70650854-70650876 CCGATGGGTTACTTCCACCCATT No data
Right 1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG No data
1069735428_1069735440 16 Left 1069735428 10:70650842-70650864 CCTGCCACAACCCCGATGGGTTA No data
Right 1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG No data
1069735433_1069735440 -10 Left 1069735433 10:70650868-70650890 CCACCCATTACTACTGTTTGCTG No data
Right 1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG No data
1069735431_1069735440 5 Left 1069735431 10:70650853-70650875 CCCGATGGGTTACTTCCACCCAT No data
Right 1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069735440 Original CRISPR CTGTTTGCTGGGTGGGTAGA TGG Intergenic
No off target data available for this crispr