ID: 1069735441

View in Genome Browser
Species Human (GRCh38)
Location 10:70650908-70650930
Sequence AACAGAGACAATTAAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069735437_1069735441 13 Left 1069735437 10:70650872-70650894 CCATTACTACTGTTTGCTGGGTG No data
Right 1069735441 10:70650908-70650930 AACAGAGACAATTAAAAAGCTGG No data
1069735436_1069735441 14 Left 1069735436 10:70650871-70650893 CCCATTACTACTGTTTGCTGGGT No data
Right 1069735441 10:70650908-70650930 AACAGAGACAATTAAAAAGCTGG No data
1069735433_1069735441 17 Left 1069735433 10:70650868-70650890 CCACCCATTACTACTGTTTGCTG No data
Right 1069735441 10:70650908-70650930 AACAGAGACAATTAAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069735441 Original CRISPR AACAGAGACAATTAAAAAGC TGG Intergenic
No off target data available for this crispr