ID: 1069735442

View in Genome Browser
Species Human (GRCh38)
Location 10:70650914-70650936
Sequence GACAATTAAAAAGCTGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069735436_1069735442 20 Left 1069735436 10:70650871-70650893 CCCATTACTACTGTTTGCTGGGT No data
Right 1069735442 10:70650914-70650936 GACAATTAAAAAGCTGGAGCAGG No data
1069735437_1069735442 19 Left 1069735437 10:70650872-70650894 CCATTACTACTGTTTGCTGGGTG No data
Right 1069735442 10:70650914-70650936 GACAATTAAAAAGCTGGAGCAGG No data
1069735433_1069735442 23 Left 1069735433 10:70650868-70650890 CCACCCATTACTACTGTTTGCTG No data
Right 1069735442 10:70650914-70650936 GACAATTAAAAAGCTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069735442 Original CRISPR GACAATTAAAAAGCTGGAGC AGG Intergenic
No off target data available for this crispr