ID: 1069735591

View in Genome Browser
Species Human (GRCh38)
Location 10:70652040-70652062
Sequence GGAGTCAGTGACTGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069735591_1069735602 20 Left 1069735591 10:70652040-70652062 CCTGCCACCCAGTCACTGACTCC No data
Right 1069735602 10:70652083-70652105 TAGAACCTAACAGGCATGTTTGG No data
1069735591_1069735596 -4 Left 1069735591 10:70652040-70652062 CCTGCCACCCAGTCACTGACTCC No data
Right 1069735596 10:70652059-70652081 CTCCCCTCAGACCTCAGTTTGGG No data
1069735591_1069735601 11 Left 1069735591 10:70652040-70652062 CCTGCCACCCAGTCACTGACTCC No data
Right 1069735601 10:70652074-70652096 AGTTTGGGCTAGAACCTAACAGG No data
1069735591_1069735595 -5 Left 1069735591 10:70652040-70652062 CCTGCCACCCAGTCACTGACTCC No data
Right 1069735595 10:70652058-70652080 ACTCCCCTCAGACCTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069735591 Original CRISPR GGAGTCAGTGACTGGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr