ID: 1069738218

View in Genome Browser
Species Human (GRCh38)
Location 10:70671478-70671500
Sequence CTGGATGCTCTGATGTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069738213_1069738218 22 Left 1069738213 10:70671433-70671455 CCTGAATTTAATATAGATCAATT No data
Right 1069738218 10:70671478-70671500 CTGGATGCTCTGATGTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069738218 Original CRISPR CTGGATGCTCTGATGTAGCT TGG Intergenic
No off target data available for this crispr