ID: 1069738433

View in Genome Browser
Species Human (GRCh38)
Location 10:70672589-70672611
Sequence CCTCGCGCGCCCGGAGCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069738426_1069738433 -3 Left 1069738426 10:70672569-70672591 CCCCGCTCTCCAGCCGGCAGCCT No data
Right 1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG 0: 1
1: 0
2: 1
3: 10
4: 108
1069738427_1069738433 -4 Left 1069738427 10:70672570-70672592 CCCGCTCTCCAGCCGGCAGCCTC No data
Right 1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG 0: 1
1: 0
2: 1
3: 10
4: 108
1069738423_1069738433 21 Left 1069738423 10:70672545-70672567 CCGGGTGCGCTGGCGCGTCAGTG No data
Right 1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG 0: 1
1: 0
2: 1
3: 10
4: 108
1069738428_1069738433 -5 Left 1069738428 10:70672571-70672593 CCGCTCTCCAGCCGGCAGCCTCG No data
Right 1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG 0: 1
1: 0
2: 1
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069738433 Original CRISPR CCTCGCGCGCCCGGAGCCAG CGG Intergenic
900180409 1:1308660-1308682 GCGCGCGCGCACGGAGCCTGAGG - Exonic
901022758 1:6263289-6263311 CCTCGCTCTCCAGGGGCCAGAGG + Intergenic
901023306 1:6266007-6266029 CCTCGCCGGCCTGGAGCCAATGG + Intronic
901641395 1:10694766-10694788 CCTCCTCCTCCCGGAGCCAGAGG - Intronic
902214303 1:14924626-14924648 CCTCGCGCGCCCGGCCCCGGCGG - Intronic
914428616 1:147600240-147600262 CCCCGCGGGGCCGGGGCCAGCGG - Intronic
915511360 1:156388598-156388620 GCTCGCCCGCCCGGAGACATTGG - Intergenic
920805690 1:209231772-209231794 CCCCGCGCGCTCGGCGCCGGTGG + Intergenic
1063381911 10:5590949-5590971 CCTCCCGCTCCAGGGGCCAGGGG + Intergenic
1065977747 10:30858141-30858163 CCTCGTGAGCCTGGATCCAGGGG - Intronic
1065993259 10:31032501-31032523 CCGCGGGAGCCGGGAGCCAGGGG - Intergenic
1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG + Intergenic
1070570715 10:77637937-77637959 CCCCGAGCGCCGAGAGCCAGGGG + Intronic
1072253724 10:93601201-93601223 CCACGCGCGCCCGGACTCGGCGG - Intronic
1072294159 10:93993772-93993794 CCCCGCGCGGCAGGAGCCGGGGG + Intergenic
1076733093 10:132447889-132447911 CCGCGGGCGCCCGGAGGCAGGGG - Exonic
1079203482 11:18394648-18394670 CCCTGCGCGCACGGCGCCAGAGG + Intronic
1082028646 11:47589716-47589738 CCAGGCGCGCCCGGAGGCCGTGG + Exonic
1082789221 11:57335732-57335754 CCTCGCGAGGCCGCAGCCTGAGG - Exonic
1084331799 11:68434773-68434795 CCTCGCTCTCCCAGAGCCACCGG + Intronic
1085396067 11:76207787-76207809 CCCCGCCCGCCCGCAGCCCGCGG + Intronic
1089398879 11:118153073-118153095 CCTCGCGGTCCCGGAGCCCCGGG + Intergenic
1097891327 12:64780687-64780709 CCTCCCGGGCGCGGCGCCAGCGG - Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103595306 12:122021691-122021713 CACCGCGCGCCCAGAGCCGGGGG + Exonic
1113082828 13:106535550-106535572 CCGCGCGCGTCCGGAGCCCGCGG - Intergenic
1118445137 14:65843778-65843800 CATCGTGGGCCTGGAGCCAGGGG - Intergenic
1119219182 14:72892890-72892912 GCTCGCGATCGCGGAGCCAGGGG - Intronic
1122739283 14:103861916-103861938 CTTAGCCTGCCCGGAGCCAGGGG + Intergenic
1123680252 15:22757873-22757895 CCTGGCGCCGCCTGAGCCAGCGG + Intergenic
1124323632 15:28737840-28737862 CGGCGCGCGCCGGCAGCCAGCGG + Intronic
1127770097 15:62224199-62224221 TCTCCCGCGCCCGCCGCCAGGGG + Intergenic
1127789911 15:62390549-62390571 TGTTCCGCGCCCGGAGCCAGCGG + Intronic
1132482393 16:173040-173062 CCTCGCCCGCCCGGACCCACAGG + Intronic
1132483241 16:176844-176866 CCTCGCCCGCCCGGACCCACAGG + Intronic
1132843512 16:1989884-1989906 CCCCGCGCGCATGGACCCAGTGG + Intronic
1133021465 16:2968796-2968818 CCTCACGCGCCCGCAGCCGTCGG - Intronic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1137426600 16:48385476-48385498 CCCCGCGCGCTGGGAGCCTGGGG + Intronic
1139548475 16:67660775-67660797 CCGCGCGCCCCCGGAGTCTGGGG - Exonic
1139664912 16:68448555-68448577 CCTCGCGCCGCCGGAGCCAATGG + Exonic
1140455818 16:75104997-75105019 CCTTACCCGCTCGGAGCCAGAGG - Intronic
1141913289 16:87075668-87075690 CCTCACGCGGCTGGGGCCAGTGG + Intergenic
1143508167 17:7380991-7381013 CCTCGCCGGCCCCGGGCCAGCGG + Exonic
1146492667 17:33293285-33293307 CCCCGCCCGCCCGGAGCCGCGGG - Intronic
1148615143 17:48996114-48996136 CCTCCGGCTCCCGGAGCCCGAGG - Intergenic
1148615144 17:48996114-48996136 CCTCGGGCTCCGGGAGCCGGAGG + Intergenic
1153493170 18:5670808-5670830 CCTAGCACGCTTGGAGCCAGGGG - Intergenic
1153636595 18:7117948-7117970 CCGCGTGCGCCGGGACCCAGAGG - Intergenic
1160453300 18:78979641-78979663 CCCCGCGCGCCCGGAACAGGAGG + Intergenic
1160691086 19:460936-460958 CCCCGCGCCCCCCGAGCCCGAGG - Exonic
1160873250 19:1286372-1286394 CCTCGCGCCCCCGGAGCTCCGGG + Intronic
1161129297 19:2578881-2578903 CCTGGGGGGCCGGGAGCCAGGGG - Intronic
1161205073 19:3036551-3036573 ACCCGCGAGCCCGGGGCCAGCGG - Intronic
1161596099 19:5151642-5151664 CCTAGGGCGACAGGAGCCAGCGG + Exonic
1161829177 19:6590470-6590492 CCTCCCCCACCCGGAGCGAGTGG + Intronic
1162831306 19:13286444-13286466 CCTGGCGTCCCTGGAGCCAGAGG - Intronic
1163815830 19:19463859-19463881 CTTCACGCTCCTGGAGCCAGAGG - Intronic
1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG + Intergenic
1166841285 19:45698713-45698735 CCTCCCTCGCCAGAAGCCAGGGG - Intronic
1167095250 19:47371975-47371997 GCTCGGGCGCCCAGAACCAGGGG + Intronic
1168056326 19:53867135-53867157 CCTGCGGCGCCCGGTGCCAGTGG + Intronic
1168714650 19:58519700-58519722 CCTCGCCCGCCCTGCGGCAGGGG + Intronic
925583990 2:5444355-5444377 CCTGGCTCGCCTGGAGCTAGCGG + Intergenic
929545715 2:42854321-42854343 CCTGGGGAGCCTGGAGCCAGCGG + Intergenic
932599388 2:73113142-73113164 CTTCGGGCGCCCCCAGCCAGGGG - Intronic
934835936 2:97589954-97589976 TCTCGCGCGCCCGGTGCAGGCGG + Exonic
938068347 2:128293621-128293643 CCTGGAGGGCCCGGAGTCAGAGG + Intronic
938271843 2:129979636-129979658 CCTGGCTCGCCCTGCGCCAGAGG + Intergenic
938444159 2:131364164-131364186 CCTGGCTCGCCCCGCGCCAGAGG - Intergenic
939613029 2:144332566-144332588 CCTGACGCGCCCGGAGGCCGAGG - Intronic
940650594 2:156436480-156436502 CCTCACGCGCGAGGGGCCAGCGG - Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
946194102 2:218022930-218022952 CCTCGCCCACCCTGAGCCAGGGG + Intergenic
946692253 2:222318943-222318965 GCTCGAGCGCACCGAGCCAGAGG + Intergenic
948802350 2:240438588-240438610 CCTCGCTGGCCCGGAGCAGGTGG + Intronic
1176100954 20:63364315-63364337 CCTGTCTCTCCCGGAGCCAGGGG + Intronic
950530296 3:13549117-13549139 CCCCGCGCGCACACAGCCAGGGG + Exonic
952942360 3:38454284-38454306 CCGCGCACACCCGGAGCCCGCGG - Exonic
954176198 3:48847668-48847690 CCTCGCGGGCGCGGAGCGAAAGG - Exonic
954392682 3:50275781-50275803 CCACGCGCGCCTGCAGCGAGCGG - Exonic
963038430 3:141051580-141051602 CCCGGCGCGCCGGGGGCCAGCGG + Exonic
967556301 3:190862926-190862948 CGCCGCGCACCCGGAGCGAGAGG - Intronic
968478896 4:825467-825489 CCCCGCGCCGCGGGAGCCAGGGG - Intronic
968816164 4:2823062-2823084 CCTCGGGCCCCCACAGCCAGCGG + Intronic
970009060 4:11438795-11438817 CCTGGGACGCCAGGAGCCAGAGG - Intergenic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
985703300 5:1386478-1386500 CCACGCGCGCCCGGCGTCAACGG - Intergenic
986391247 5:7289853-7289875 CCTGGCGCCGCCTGAGCCAGCGG + Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
994359981 5:98839636-98839658 CCCGGCGCCCCCGGAGCCAGCGG + Intergenic
995512464 5:112922362-112922384 CCTCCCCCGCCCAGCGCCAGGGG + Exonic
1001984217 5:176060603-176060625 CGTGGCGCGCCCGCAGCAAGTGG + Intronic
1002233258 5:177783462-177783484 CGTGGCGCGCCCGCAGCAAGTGG - Intronic
1002262720 5:178006319-178006341 CGTGGCGCGCCCGCAGCAAGTGG + Intergenic
1002632640 5:180591381-180591403 CCGTGCGCGCCAGGAGCCCGGGG + Intronic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1006472288 6:34235843-34235865 CCTCCCGCGCCCGGTCCCCGAGG - Intergenic
1009431748 6:63572974-63572996 CCTCCCGAGCCCGGAGCGACGGG + Intronic
1010752543 6:79631407-79631429 CCACGCCAGCCCGGAGCCCGGGG + Exonic
1011643085 6:89433266-89433288 CCTGGGGCCGCCGGAGCCAGCGG + Intronic
1013099430 6:106974700-106974722 CTGCGCCCGCCCGGAGCCAGCGG - Intronic
1017012027 6:150069380-150069402 CCTGGCCCGCGCGGAGCCTGGGG - Intergenic
1019473630 7:1233734-1233756 CCCGGCGCGCCCAGAGCCTGGGG - Intronic
1019504539 7:1384197-1384219 CGTCGGGCGCAGGGAGCCAGGGG + Intergenic
1020136897 7:5592715-5592737 CCCCTCCCGCGCGGAGCCAGGGG + Intergenic
1029640664 7:101817121-101817143 CCTCCCGCGCCCGCACCCGGCGG - Intronic
1029730007 7:102433152-102433174 CCTTTTGCGCCCGGACCCAGGGG + Intronic
1030014354 7:105203685-105203707 CCCCACACCCCCGGAGCCAGAGG - Exonic
1031011196 7:116526256-116526278 CCTCCCCCGCCCGCCGCCAGGGG - Intronic
1032501679 7:132404438-132404460 CCTCACAGGCCCAGAGCCAGGGG + Intronic
1045216896 8:100158016-100158038 CGTCGCCCGGCCCGAGCCAGAGG - Intronic
1046871287 8:119208357-119208379 CGCGGCGCGCCCGGAGCCCGCGG + Exonic
1057869690 9:98708616-98708638 CCTCTGGCGCCCGGGGCCTGGGG - Exonic
1061222147 9:129258504-129258526 CCGAGCGCGCCCGGAGCAGGAGG - Intergenic
1062567419 9:137169460-137169482 GCTGGCGCGCCTGGAGCCCGCGG - Exonic
1189446220 X:41084613-41084635 CCTCGCGCCCCCGCAGCCAGTGG + Intergenic
1192465050 X:71348733-71348755 CCTCCCCAGCCCTGAGCCAGAGG - Intergenic
1200107824 X:153724549-153724571 CCCTGCTCGCCCGGAGCCCGAGG - Intronic
1201895883 Y:18992763-18992785 CTGCGCCCGCCCGGAGCCAGCGG - Intergenic