ID: 1069738635

View in Genome Browser
Species Human (GRCh38)
Location 10:70673578-70673600
Sequence CCCCTAAGACTGCTGCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069738635_1069738642 13 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738642 10:70673614-70673636 TGGGGATGAAACTAGAGCTGTGG No data
1069738635_1069738646 21 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738646 10:70673622-70673644 AAACTAGAGCTGTGGGCATGGGG No data
1069738635_1069738639 -6 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738639 10:70673595-70673617 TAGGGGTCCTCTGCTATAATGGG No data
1069738635_1069738638 -7 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738638 10:70673594-70673616 TTAGGGGTCCTCTGCTATAATGG No data
1069738635_1069738647 22 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738647 10:70673623-70673645 AACTAGAGCTGTGGGCATGGGGG No data
1069738635_1069738643 14 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738643 10:70673615-70673637 GGGGATGAAACTAGAGCTGTGGG No data
1069738635_1069738640 -5 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738640 10:70673596-70673618 AGGGGTCCTCTGCTATAATGGGG No data
1069738635_1069738644 19 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738644 10:70673620-70673642 TGAAACTAGAGCTGTGGGCATGG No data
1069738635_1069738645 20 Left 1069738635 10:70673578-70673600 CCCTCTTGCAGCAGTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1069738645 10:70673621-70673643 GAAACTAGAGCTGTGGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069738635 Original CRISPR CCCCTAAGACTGCTGCAAGA GGG (reversed) Intronic
900081644 1:863018-863040 CCTCTGAGATTGGTGCAAGATGG - Intergenic
903365206 1:22801785-22801807 CCACAAAGACTGCAGCACGAGGG - Intronic
906530485 1:46520957-46520979 CCCATGAGGCTGCTGCAGGAGGG - Intergenic
912865560 1:113253099-113253121 CCCCTAAAACATCTGAAAGAGGG - Intergenic
915784037 1:158587678-158587700 CTTCTAACACTGCTGCAACAGGG - Intergenic
920310708 1:205046645-205046667 CCCCCAACTCTGCTGCAAGGAGG - Intronic
1063728040 10:8661403-8661425 CCACTGTGACTGCTGTAAGATGG - Intergenic
1067656867 10:48199809-48199831 CCCCCAAGACAACTGCAAGACGG - Intronic
1069738635 10:70673578-70673600 CCCCTAAGACTGCTGCAAGAGGG - Intronic
1072729560 10:97836447-97836469 CCCCCAAAACTGCTTCCAGATGG + Intergenic
1075555846 10:123431308-123431330 CCCCTAACAGTGCTGCAATCTGG - Intergenic
1076013239 10:127007028-127007050 CCCCCAAGAGTGCTGGAAGCTGG + Intronic
1083965207 11:66039616-66039638 CCCCTAGGACTCCTGCAAAGAGG - Intergenic
1086541983 11:87924112-87924134 CCCCTAACACACCTGTAAGAAGG + Intergenic
1087153722 11:94881341-94881363 CCCCTCAGAGAGCTGAAAGAGGG - Intergenic
1090464198 11:126919265-126919287 CCCCTAAGACAGGAGCAAGCTGG + Intronic
1091135375 11:133184084-133184106 ACCCTAATCCTGCAGCAAGAGGG + Intronic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1096670221 12:53194048-53194070 CCACTCAGACTGCTCCAGGAAGG + Exonic
1096750083 12:53752975-53752997 CCCCCAAGACTCCTGCACCAAGG + Intergenic
1106915093 13:34505233-34505255 CTCCTGAGCCTGGTGCAAGATGG - Intergenic
1111285571 13:86088100-86088122 CCCATAAGACTGCTGCATATGGG - Intergenic
1112916666 13:104559475-104559497 CCACTCTGACTGGTGCAAGATGG + Intergenic
1114620874 14:24095233-24095255 CCACTTAGAGGGCTGCAAGAGGG + Intronic
1122004106 14:98688003-98688025 CCCCTAACACTGCTCCATCAGGG + Intergenic
1126451263 15:48811389-48811411 CCCGTAAGACTGCTGCACCCTGG - Intergenic
1126917560 15:53483022-53483044 CCCTTAAAACTGCTGGAAGCTGG + Intergenic
1127828014 15:62722772-62722794 CCCCTAAGACTTGTGAAAAATGG - Intronic
1129528309 15:76238481-76238503 CCCCTAAGACTGCCTCAATCAGG + Intronic
1129817899 15:78571959-78571981 CTCCTAGGACTGCTGCAAAGAGG + Intronic
1129900084 15:79140729-79140751 CCACTAAGACTACTGTAAAAGGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131628788 15:94153430-94153452 CCACTATGAATACTGCAAGAAGG + Intergenic
1134446479 16:14335143-14335165 CCCCCAACACTGCTGCAGAAAGG + Intergenic
1136101571 16:28000573-28000595 CCCTCCAGACTGGTGCAAGAGGG + Intronic
1136384675 16:29916197-29916219 CCTTTAAGACAGCTGCAATAAGG - Intronic
1139114404 16:63932049-63932071 CCAGTCTGACTGCTGCAAGATGG + Intergenic
1140354576 16:74294470-74294492 TGCCTAAGACTGCTGCAAGCAGG + Intergenic
1143436406 17:6931118-6931140 CCCCTAAGAGAGGTGCAAGGAGG - Intronic
1148936790 17:51169582-51169604 CCCAGAAGACTGCTAGAAGAGGG - Intronic
1150891676 17:69158197-69158219 ACACTAACACTGTTGCAAGAAGG - Intronic
1152273790 17:79341964-79341986 CCCCCAAGGCTGGGGCAAGAGGG + Intronic
1152630177 17:81407439-81407461 CCCCTGAGACTTCTGCAACCAGG + Intronic
1156469372 18:37367939-37367961 CCCCTGACTCTGCTGGAAGATGG - Intronic
1158199112 18:54920647-54920669 CCATTATGACTGCTGCGAGATGG - Intronic
1159887763 18:73925254-73925276 CCTCTAAGAGGGCTGCGAGATGG + Intergenic
1160232577 18:77058979-77059001 CCCCTGAGGCTGCCCCAAGATGG + Intronic
1160795996 19:945687-945709 GCCCAAAGACGGCTGCAGGAAGG - Intronic
1164821750 19:31256158-31256180 CTCATAGGACTGCTGCAGGATGG + Intergenic
925889721 2:8423891-8423913 CCCATGAGACTGCTTCATGAGGG + Intergenic
927509474 2:23635430-23635452 CCTCTGAGACTGCTGCAGGGTGG + Intronic
927943168 2:27118548-27118570 CCCCCAGGACTGCTGGAACACGG + Intronic
932210263 2:69922303-69922325 CCACTCAGGCTGCGGCAAGATGG - Intronic
933177255 2:79189543-79189565 CCGATAATATTGCTGCAAGAGGG + Intronic
934735853 2:96689464-96689486 CCCCTAAGCCTGGTGCCAGAGGG + Intergenic
937125897 2:119474809-119474831 CCCCTGAGACTTCAGGAAGAGGG - Intronic
942288791 2:174449182-174449204 CCCTTCTGACTGATGCAAGACGG - Intronic
946302296 2:218831350-218831372 CCCCCAAGGCTGCTCCAGGAAGG + Exonic
947603390 2:231468276-231468298 CCCCTGAGCCTGCTGGAGGAGGG + Intronic
947636628 2:231683634-231683656 CTCCCAAGACTGCAGCAGGAAGG + Intergenic
1169411430 20:5373815-5373837 CCCCTCACACTGCTGCCAGAAGG - Intergenic
1170730515 20:18970914-18970936 CCTCTTACACTGCTGCAAGCAGG + Intergenic
1173286555 20:41676576-41676598 CCCCCAAAACTGCTGGAAGTAGG + Intergenic
1174291816 20:49514177-49514199 CCCCTAAGACTGCGTCATCATGG - Intronic
1177809435 21:25909622-25909644 CTCCTAAGGCTGATGCAACAAGG + Intronic
1177914145 21:27067419-27067441 CCACTCAGACTGCTGTGAGATGG - Intergenic
1178928338 21:36794357-36794379 CCCTGAAGGCTGCTGCAATAAGG + Intronic
1179712168 21:43269550-43269572 GCCCAAAGAGTGCTGCAAGGGGG + Intergenic
1181318939 22:21990038-21990060 GCGCTGAGGCTGCTGCAAGATGG + Intergenic
1181782769 22:25205090-25205112 CCCCCAAACCTGCTGCAGGAGGG - Intronic
1183267846 22:36840340-36840362 CCCCTTGGCCTGCTCCAAGAAGG - Intergenic
1183334179 22:37237255-37237277 TCCCTAAGACTTCTCCAAGAGGG - Intronic
949611567 3:5708399-5708421 CCCCTGAGGCCGCTGCAAGGGGG + Intergenic
950555630 3:13694221-13694243 CTCCCAAGACTGCTCCAGGAGGG - Intergenic
951543330 3:23803625-23803647 CCCCTAAGACAGCTGCATACAGG + Intergenic
952654952 3:35774396-35774418 CATCTAAGACTGATCCAAGAGGG - Intronic
954489792 3:50892744-50892766 ACCCTAAGATTTCTGCAGGAGGG + Intronic
957770680 3:84687890-84687912 CTCCTAAGCCTCCTGTAAGAGGG - Intergenic
960785909 3:121372567-121372589 CCCCAATGACTCCTGCAAAAGGG - Intronic
967290565 3:187915624-187915646 CTCCTATAACTGCTGCCAGAAGG - Intergenic
970118436 4:12725692-12725714 CCCCCAAGGTTGCTGCAAAAGGG + Intergenic
974814270 4:66985209-66985231 CCACTAAGATTGATGAAAGAGGG + Intergenic
977163822 4:93671118-93671140 ATCCTAAGACTGCTGGAAAAGGG + Intronic
977184160 4:93916194-93916216 GCTCAAAGACTGCTGCAAGTGGG + Intergenic
980558067 4:134434941-134434963 TCCCTGAGACTGATGTAAGATGG - Intergenic
982565278 4:156978017-156978039 GCACAAAGACTGCTGCATGAAGG + Intergenic
985078393 4:186241302-186241324 CCCCTAAGGCTCCTGGAAGGAGG + Intronic
986004378 5:3656079-3656101 CCCCTGACACATCTGCAAGAAGG + Intergenic
988808504 5:34762509-34762531 CCTCTAAGACTGATCAAAGAGGG + Intronic
992625508 5:78633024-78633046 CTCCTAAAGCAGCTGCAAGAAGG - Intronic
997440057 5:133902800-133902822 CCCCCAAGCCTTCTGCCAGATGG + Intergenic
997628525 5:135348528-135348550 GTCCTGAGACTGCTGGAAGAAGG - Intronic
1004070380 6:12292043-12292065 TCCCTGAGCCTGCTTCAAGAGGG + Intronic
1005841020 6:29744708-29744730 CCCCTAGGCTTGCTGGAAGATGG + Intergenic
1007246397 6:40466330-40466352 CCCCTAAAATTGCAGAAAGATGG - Intronic
1007728301 6:43930181-43930203 CCCCTAAGGGTGGTGGAAGAAGG - Intergenic
1017277790 6:152590039-152590061 CTCCTGAGACTGAGGCAAGAGGG - Intronic
1018344635 6:162888035-162888057 CTCCTGAGGCTGCTGCAACAAGG - Intronic
1028515171 7:91670324-91670346 CTCCTAACACTCCTGTAAGATGG - Intergenic
1031478460 7:122250498-122250520 CCCCTCAGCATGCTGCAAGCTGG + Intergenic
1035523625 8:294532-294554 CCTCTGAGATTGGTGCAAGACGG + Intergenic
1036124019 8:6046721-6046743 CCCCCAAAACTGCGGCAAGGAGG + Intergenic
1036823434 8:11957647-11957669 CCCATGAGACAGCTGCCAGAAGG - Intergenic
1037321003 8:17642576-17642598 CCACAAAGACTGAAGCAAGAGGG - Intronic
1038449131 8:27627778-27627800 CCCCTAAGGTGGCTGCAAAATGG - Intergenic
1039363286 8:36903343-36903365 CCCCTAACCCTGCAGCATGAAGG + Intronic
1039570541 8:38582788-38582810 CCCCTAAGAGTTCAGCAAAATGG + Intergenic
1039871736 8:41551437-41551459 CCTATAAGACTCCTCCAAGATGG - Intergenic
1041622592 8:59990181-59990203 CCCCTAAATCTGCTGGAACAAGG + Intergenic
1042229251 8:66540407-66540429 CCCTCTAGACTGCTGCAAGCTGG + Intergenic
1045112272 8:98947327-98947349 CCCCTAAGTCTGCTCACAGATGG + Intronic
1050560257 9:6828078-6828100 CCCCTGAGAATGGTGCAAGTAGG + Intronic
1058961048 9:109993388-109993410 TCCCTTAGAATGCTGGAAGAAGG - Intronic
1059984701 9:119810798-119810820 CCTCTGGGACTGCTGCAGGATGG + Intergenic
1061978430 9:134085579-134085601 CCCCTAATACTGCTGGAATGGGG + Intergenic
1062600038 9:137315482-137315504 CCCCCAAGTCTGCTGCAACAGGG - Intronic
1194427598 X:93759072-93759094 CTCCAAAGAATGCTGCAATATGG - Intergenic
1196942521 X:120791381-120791403 CCACTAAGAATGCTGCAGCAGGG - Intergenic
1197649968 X:129053763-129053785 CCCCTCAGACAGATGCATGAAGG - Intergenic
1199712281 X:150477799-150477821 CCCCTGAGCCTGCTGCAAGCAGG - Intronic