ID: 1069739574

View in Genome Browser
Species Human (GRCh38)
Location 10:70678955-70678977
Sequence AGGCCCTCCATAACAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 276}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069739574_1069739584 3 Left 1069739574 10:70678955-70678977 CCACCCACTGTTATGGAGGGCCT 0: 1
1: 0
2: 2
3: 9
4: 276
Right 1069739584 10:70678981-70679003 GGGTGTCCTAGCTGTGGGAGGGG No data
1069739574_1069739583 2 Left 1069739574 10:70678955-70678977 CCACCCACTGTTATGGAGGGCCT 0: 1
1: 0
2: 2
3: 9
4: 276
Right 1069739583 10:70678980-70679002 TGGGTGTCCTAGCTGTGGGAGGG No data
1069739574_1069739582 1 Left 1069739574 10:70678955-70678977 CCACCCACTGTTATGGAGGGCCT 0: 1
1: 0
2: 2
3: 9
4: 276
Right 1069739582 10:70678979-70679001 CTGGGTGTCCTAGCTGTGGGAGG No data
1069739574_1069739581 -2 Left 1069739574 10:70678955-70678977 CCACCCACTGTTATGGAGGGCCT 0: 1
1: 0
2: 2
3: 9
4: 276
Right 1069739581 10:70678976-70678998 CTTCTGGGTGTCCTAGCTGTGGG No data
1069739574_1069739586 20 Left 1069739574 10:70678955-70678977 CCACCCACTGTTATGGAGGGCCT 0: 1
1: 0
2: 2
3: 9
4: 276
Right 1069739586 10:70678998-70679020 GAGGGGAAAGAGAAAGATCCAGG No data
1069739574_1069739580 -3 Left 1069739574 10:70678955-70678977 CCACCCACTGTTATGGAGGGCCT 0: 1
1: 0
2: 2
3: 9
4: 276
Right 1069739580 10:70678975-70678997 CCTTCTGGGTGTCCTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069739574 Original CRISPR AGGCCCTCCATAACAGTGGG TGG (reversed) Intronic
900475984 1:2876618-2876640 AGGCTCCCCATCAGAGTGGGAGG + Intergenic
900628510 1:3621152-3621174 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
900664626 1:3806452-3806474 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
900957245 1:5893679-5893701 AGGCCCTCCACAAGAGATGGAGG + Intronic
901040989 1:6363394-6363416 AGGCCCTCCACAAGAGGTGGAGG - Intronic
901232132 1:7647166-7647188 AGGGCCTCCGGAACAGAGGGAGG - Intronic
902575935 1:17377593-17377615 AGTCCCTCCATCACAGTAGGCGG + Intronic
903487938 1:23705396-23705418 AGGCCCTCCAGAATGGTGGAGGG + Intergenic
908818535 1:68058399-68058421 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
909455278 1:75842854-75842876 AGGCCCTCCACAAGAGGTGGAGG - Intronic
910750386 1:90622779-90622801 AGGCCCTTGATAACACTGTGTGG - Intergenic
914378855 1:147098376-147098398 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
918277711 1:182969709-182969731 CGGCCCTCCATATCTGTGGGGGG + Intergenic
918432477 1:184476360-184476382 AGGGCCTGTATTACAGTGGGAGG + Intronic
920998568 1:211018587-211018609 AGGCCCTGCATGACAGTGAATGG - Intronic
1063985245 10:11494944-11494966 AGGCCCTCCACAAAAGGTGGAGG + Intronic
1064018799 10:11793110-11793132 AGGCCCTCCACAAAAGGTGGAGG - Intergenic
1067673345 10:48346598-48346620 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1069739574 10:70678955-70678977 AGGCCCTCCATAACAGTGGGTGG - Intronic
1072863295 10:99029817-99029839 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1074154555 10:110786911-110786933 AGCCCCTCCATAAAGGGGGGTGG + Intronic
1076419627 10:130321714-130321736 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1076894782 10:133305058-133305080 AGGCCCTCCACAAGAGTTGGAGG - Intronic
1076918348 10:133438095-133438117 AGGCCCTCCACAAGAGGTGGTGG - Intergenic
1077006776 11:361897-361919 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1077264989 11:1644143-1644165 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1077388340 11:2286399-2286421 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1077520084 11:3027915-3027937 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1077929103 11:6711899-6711921 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1082580067 11:54855412-54855434 AGACCCTCCACAAGAGTTGGAGG - Intergenic
1082689039 11:56277576-56277598 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1083349417 11:62016766-62016788 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1083502969 11:63128447-63128469 AGGCCCTCCACAAGAGGTGGTGG - Intronic
1083553153 11:63606156-63606178 AGGCCCTCCAAAGCAGAGGTGGG - Intronic
1083596070 11:63918778-63918800 AGGCCCTGCCTAATAGGGGGCGG - Intergenic
1083910540 11:65706581-65706603 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1083910565 11:65706730-65706752 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090400816 11:126447254-126447276 AGCCCCTCCATCCCAGTGGCGGG + Intronic
1092224918 12:6741989-6742011 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1092444159 12:8538159-8538181 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1092449023 12:8584829-8584851 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1092538815 12:9407112-9407134 AGGACCCCCATCGCAGTGGGGGG + Intergenic
1092557022 12:9569692-9569714 AGGACCCCCATCGCAGTGGGGGG - Intergenic
1094513988 12:31117591-31117613 AGGTCCCCCATCGCAGTGGGGGG + Intergenic
1094514592 12:31119543-31119565 AGGACCCCCATCGCAGTGGGGGG + Intergenic
1096576752 12:52557701-52557723 AGGCCCTCCCTTCCTGTGGGAGG - Intergenic
1096820521 12:54230271-54230293 AGGCCTCACATATCAGTGGGAGG + Intergenic
1097089949 12:56497048-56497070 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1097090558 12:56501222-56501244 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1098935371 12:76472882-76472904 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1101390336 12:104294177-104294199 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1101776517 12:107799476-107799498 AGGCCCTCCACAAGAGTTGGAGG + Intergenic
1103357961 12:120335780-120335802 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1104490375 12:129188960-129188982 AGGTCCTCCAGGAAAGTGGGTGG - Intronic
1104878254 12:132051763-132051785 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1105019945 12:132809358-132809380 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1105020153 12:132810784-132810806 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1105404098 13:20119182-20119204 GGGCCTTCCTTAACAGTCGGCGG + Intergenic
1105856339 13:24375856-24375878 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1105876144 13:24555069-24555091 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1108220274 13:48226794-48226816 AGGCCTTCCATAACCTTGCGTGG - Intergenic
1109545652 13:63837977-63837999 AGGACCCCCATCGCAGTGGGGGG + Intergenic
1109546682 13:63842228-63842250 AGGACTCCCATCACAGTGGGGGG + Intergenic
1109547152 13:63844272-63844294 AGGACCTCCATCACAGTGGGGGG + Intergenic
1110892455 13:80707712-80707734 AGGACCCCCATCAGAGTGGGGGG + Intergenic
1113880317 13:113621813-113621835 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1114165786 14:20216995-20217017 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1115176024 14:30562637-30562659 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1115821275 14:37214916-37214938 AGGCCCTCCACAAGAGATGGTGG - Intronic
1117632591 14:57709120-57709142 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1119025272 14:71147685-71147707 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1121631906 14:95427351-95427373 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1127459142 15:59182065-59182087 AGTCCCACTATATCAGTGGGCGG - Intronic
1127752152 15:62056612-62056634 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1127877590 15:63123944-63123966 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1129921132 15:79320004-79320026 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1132738946 16:1401401-1401423 AAGCCCTCCCCAACAGGGGGTGG - Intronic
1132966825 16:2660773-2660795 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1132967957 16:2670040-2670062 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1133010330 16:2907060-2907082 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1133108148 16:3527578-3527600 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1134400470 16:13905172-13905194 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1135670929 16:24374908-24374930 AGGCCCTCCATAAGAGGTAGAGG + Intergenic
1136319183 16:29471462-29471484 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1136352718 16:29721591-29721613 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1136433754 16:30210806-30210828 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1137229907 16:46554701-46554723 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1138591981 16:58005252-58005274 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1139563615 16:67759135-67759157 GGGCCGTCCAGAACAGAGGGTGG - Intronic
1140570865 16:76104631-76104653 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1140703372 16:77603226-77603248 AGGACCTCCAGAATAATGGGTGG + Intergenic
1142368929 16:89667037-89667059 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1142384293 16:89752923-89752945 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1142389999 16:89793113-89793135 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1142587420 17:982259-982281 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1143464461 17:7126732-7126754 AGGCCCTCCACAAGAGATGGAGG - Intergenic
1145223465 17:21107946-21107968 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1145731999 17:27197894-27197916 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1146356104 17:32135570-32135592 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1147836842 17:43338921-43338943 AGGCCCTCCATAAGAGATGGTGG + Intergenic
1147838048 17:43349134-43349156 AGGCCCTCCACAAGAGGTGGTGG + Intergenic
1148198702 17:45733456-45733478 GGCCCCTCCTGAACAGTGGGAGG - Intergenic
1148401122 17:47362536-47362558 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1150858326 17:68774588-68774610 AGGCCCTCCACAAGAGGTGGTGG - Intergenic
1153163104 18:2230715-2230737 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1155158371 18:23176823-23176845 AGGCCCTTCAGAACAGAGGAAGG + Intronic
1157859358 18:51126592-51126614 AAGCCCTCCATAAAAGTCAGAGG + Intergenic
1161179785 19:2872185-2872207 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1161450433 19:4342755-4342777 CGGCCCTCCATACCCTTGGGCGG - Intronic
1161894081 19:7067168-7067190 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1162290458 19:9776233-9776255 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1162613133 19:11771864-11771886 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1162729949 19:12712377-12712399 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1163371339 19:16902899-16902921 GGGCCCTCCATAACAGGTGCAGG + Intronic
1163456293 19:17407758-17407780 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1163471360 19:17499068-17499090 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1163479382 19:17545868-17545890 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1163546741 19:17945188-17945210 AGGTCATCCATAACAGTGGGGGG + Intergenic
1163881830 19:19930418-19930440 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1163885196 19:19959202-19959224 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1164083501 19:21880767-21880789 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1164084656 19:21890033-21890055 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1164261542 19:23572162-23572184 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1164955199 19:32377123-32377145 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1165671236 19:37681046-37681068 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1166433982 19:42751685-42751707 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1166449351 19:42884901-42884923 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1166453765 19:42923136-42923158 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1166466026 19:43031691-43031713 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1166472162 19:43087756-43087778 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1166915023 19:46189438-46189460 AGGCCCTCCACAAGAGGTGGTGG + Intergenic
1167370037 19:49075204-49075226 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1167392892 19:49208286-49208308 AGGCCCTCCACAAGAGGTGGTGG + Intronic
1167400720 19:49266705-49266727 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1167519038 19:49941363-49941385 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1167719604 19:51169322-51169344 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1167970304 19:53185137-53185159 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1167971404 19:53189724-53189746 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1167979108 19:53258068-53258090 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1167990991 19:53360529-53360551 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1168131508 19:54322897-54322919 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1168215125 19:54919654-54919676 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1168480925 19:56719040-56719062 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1168603395 19:57738669-57738691 AGGCCCTCCACAAGAGACGGAGG - Intronic
1168680333 19:58310767-58310789 AGGCCCTCCACAAGAGGTGGAGG + Intronic
926746362 2:16161652-16161674 AGGGCTTCCATAAAACTGGGTGG - Intergenic
928365499 2:30697557-30697579 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
928773959 2:34736550-34736572 AGGCAACCCATAACAGTGAGAGG - Intergenic
930115712 2:47716668-47716690 AGGCCCTCCACAAGAGGTGGAGG - Intronic
931721485 2:65070393-65070415 AGGCCCTCAGTATCATTGGGAGG + Intronic
932672977 2:73754224-73754246 AGGCCCTCCATAAGAGGTGGAGG - Intergenic
934543184 2:95193266-95193288 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
934754856 2:96817685-96817707 AGGCCATCGATCAGAGTGGGAGG + Intronic
935881848 2:107573210-107573232 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
936388231 2:112049605-112049627 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
938168563 2:129055346-129055368 AGGCCATCCTGGACAGTGGGGGG + Intergenic
939345737 2:140964353-140964375 AGGCCCTCCACAAGAGGTGGAGG + Intronic
940357107 2:152755342-152755364 AGGCCCTCCACAAGAGGTGGAGG - Intronic
941928206 2:170916427-170916449 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
942705402 2:178765980-178766002 AGGCACTCCATATCAGAGGCTGG + Intronic
943084432 2:183295388-183295410 AGGCCCTCCACAAGAGGTGGTGG - Intergenic
945273846 2:207968541-207968563 AAGCCCTCCATAGCCTTGGGAGG + Intronic
945779604 2:214153044-214153066 AGGCCCTCCACAAGAGGTGGAGG + Intronic
945816753 2:214614197-214614219 AGGACCTCCATGACATTGGTGGG + Intergenic
946045547 2:216818032-216818054 AGGCACTCTATACCAGTGTGAGG - Intergenic
946182235 2:217955629-217955651 AGCCCCTCCTAAGCAGTGGGAGG + Intronic
947616068 2:231557592-231557614 AGCCCCTCCCTCACAGTGAGTGG - Intergenic
947793548 2:232880815-232880837 AGCACCCCCATCACAGTGGGAGG - Intronic
948813114 2:240495296-240495318 AGGCCCTCCACAAGAGGTGGTGG - Intronic
1169295532 20:4394135-4394157 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1172537719 20:35687192-35687214 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1174039206 20:47687138-47687160 CGGCCCTCGAGAACAGTGAGGGG + Intronic
1174729855 20:52905317-52905339 AGGCCCTCCATCACAGCAGATGG - Intergenic
1176420328 21:6508885-6508907 AGGCCCTCCACAAGAGATGGAGG + Intergenic
1179695820 21:43117205-43117227 AGGCCCTCCACAAGAGATGGAGG + Intergenic
1179916161 21:44479612-44479634 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1180200974 21:46223969-46223991 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1180830805 22:18905175-18905197 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1181598040 22:23930376-23930398 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1181729899 22:24837518-24837540 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1181837831 22:25625596-25625618 AGGCCCTCCACAAAAGGTGGAGG - Intronic
1182965209 22:34514968-34514990 AGGCCCTCCAGAATTGAGGGAGG + Intergenic
1184344437 22:43904436-43904458 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1185328742 22:50241446-50241468 AGGCCCTCCACAAGAGGTGGTGG - Intronic
1185336641 22:50273687-50273709 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1203280894 22_KI270734v1_random:130446-130468 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
949544343 3:5059753-5059775 ATGCAATCTATAACAGTGGGGGG - Intergenic
949883779 3:8679429-8679451 AGGACCCCCATCACAGCGGGGGG + Intronic
949884138 3:8681147-8681169 AGGACTTCCATAGCAGGGGGGGG + Intronic
953473589 3:43186917-43186939 TGGCCCTCCAGAACAGGGAGGGG - Intergenic
956504188 3:69920349-69920371 AGGCCCTCCACAAGAGGTGGAGG - Intronic
964101397 3:152992375-152992397 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
965439795 3:168698913-168698935 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
965643975 3:170860546-170860568 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
966815549 3:183886996-183887018 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
968050842 3:195653972-195653994 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
968104983 3:195994366-195994388 AGGCCCTCCACAAGAGGAGGAGG + Intergenic
968108557 3:196022401-196022423 AGGCCCTCCACAAAAGGTGGAGG - Intergenic
968303277 3:197631953-197631975 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
968397781 4:259587-259609 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
968404730 4:330093-330115 AGGCCCTCCACAAGAGGTGGTGG + Intergenic
968559141 4:1267960-1267982 AGGCCCTCCACAAGAGGTGGTGG + Intergenic
972286860 4:37657581-37657603 AGGCCTTCCTTTATAGTGGGTGG + Intronic
974493386 4:62595600-62595622 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
974694239 4:65344713-65344735 AGGCCCTGCAGAACACTGCGTGG - Intronic
975387478 4:73774085-73774107 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
975632268 4:76415927-76415949 AGGCCCTCCACAAGAGGTGGAGG - Intronic
977742590 4:100504823-100504845 AGGCCCTCCACAAGAGGTGGAGG - Intronic
978019025 4:103785786-103785808 AGCCCTTGGATAACAGTGGGAGG - Intergenic
978308115 4:107354325-107354347 AGGCCCTCCACAAGAGGTGGTGG + Intergenic
982763408 4:159315938-159315960 AGGCCCTCCACAAGAGGTGGAGG + Intronic
982939571 4:161532624-161532646 AGACACACAATAACAGTGGGGGG + Intronic
983011293 4:162550708-162550730 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
983430452 4:167643329-167643351 ATGCCCTCCATAAAAGTTGCAGG - Intergenic
985393420 4:189515268-189515290 ACACCCTACATAACAGTGTGTGG - Intergenic
985613314 5:903090-903112 AGGCCCTCCACAAGAGGTGGAGG + Intronic
985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG + Intronic
987359722 5:17095890-17095912 AGGCCCTCCACAAAAGGTGGAGG + Intronic
988161926 5:27529570-27529592 AGCCTCACAATAACAGTGGGAGG - Intergenic
997971982 5:138411022-138411044 AGGCCCTCCACAAGAGGTGGAGG + Intronic
998539334 5:142965285-142965307 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1002205772 5:177561604-177561626 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1006652131 6:35560225-35560247 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1008477182 6:51944702-51944724 AGGCCCTCCACACCATTTGGGGG - Intronic
1011025895 6:82868699-82868721 ATGTTCTCCAGAACAGTGGGAGG + Intergenic
1011328326 6:86175160-86175182 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1012526912 6:100188852-100188874 TGGCCCTCCATCACATTGGACGG + Intergenic
1013470270 6:110457928-110457950 AGGCCCTCCACAAGAGGTGGTGG - Intronic
1013589483 6:111608137-111608159 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1015244909 6:131064074-131064096 AAGACCTCAATAAAAGTGGGAGG - Intergenic
1017774763 6:157672372-157672394 AGGCCATCTACAGCAGTGGGTGG - Intronic
1022705754 7:32800804-32800826 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1023579720 7:41668801-41668823 ATGACCTCCATAACAATGGCTGG + Intergenic
1026731785 7:72918193-72918215 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1028489872 7:91399337-91399359 GGGCCCTACATTATAGTGGGAGG - Intergenic
1029277458 7:99415533-99415555 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1029345946 7:99979028-99979050 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1029699685 7:102238145-102238167 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1034606339 7:152319603-152319625 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1037057228 8:14457477-14457499 AGGCCCTCCACAAGAGTTGGAGG - Intronic
1037574118 8:20184786-20184808 AGGCCCTGCATGTAAGTGGGGGG - Intergenic
1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG + Intergenic
1037662314 8:20938666-20938688 AGGGCTTCCAGAACAGTTGGTGG - Intergenic
1039704862 8:39996169-39996191 AGGCCCTCCACAAGAGGTGGTGG - Intronic
1040105025 8:43536750-43536772 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1040622326 8:49103576-49103598 AGGTCCTCCATAATACTGAGAGG - Intergenic
1040906762 8:52477047-52477069 AGGAGCTGCATAACAGTGAGAGG - Intergenic
1042491262 8:69401206-69401228 ATGCCATCCATAACACTGTGAGG + Intergenic
1045276159 8:100707721-100707743 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1046067482 8:109213869-109213891 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1046521346 8:115330598-115330620 AGGCGCTCCAGAGCAGGGGGTGG + Intergenic
1048241044 8:132741822-132741844 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1049458751 8:142710289-142710311 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1049561672 8:143315143-143315165 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1049666218 8:143844290-143844312 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1049810617 8:144567529-144567551 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1049857188 8:144870017-144870039 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1049880027 8:145055591-145055613 AGGCCCTCCACAAGAGGTGGAGG - Exonic
1049881350 8:145066270-145066292 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1050075450 9:1858026-1858048 AGGCCATCCAGCACAGTAGGAGG + Intergenic
1052718718 9:32148891-32148913 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1054691155 9:68322452-68322474 AGGACCCCCATCGCAGTGGGGGG - Intergenic
1055064255 9:72102645-72102667 AGGCCCAGTTTAACAGTGGGAGG + Intergenic
1055476244 9:76666308-76666330 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1057554463 9:96076609-96076631 AGGCCCTCCACAAAAGGTGGAGG - Intergenic
1057697973 9:97340839-97340861 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1058159233 9:101549527-101549549 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1059935479 9:119306077-119306099 AGTCTGTCCATAAGAGTGGGTGG + Intronic
1060247255 9:121957267-121957289 AGGCCCTCCACCACCATGGGAGG + Intronic
1061039212 9:128129976-128129998 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1061040523 9:128138708-128138730 AGGACCCCCATCGCAGTGGGGGG - Intergenic
1061040580 9:128138867-128138889 AGGACCCCCATCGCAGTGGGGGG - Intergenic
1061040717 9:128139265-128139287 AGGACCCCCGTAGCAGTGGGGGG - Intergenic
1061048763 9:128181819-128181841 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1061535373 9:131245065-131245087 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1061787812 9:133041246-133041268 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1062183928 9:135206349-135206371 AGGCCCTCCACAAGAGATGGAGG + Intergenic
1062557200 9:137119024-137119046 AGGCCCTCCACAAGAGGTGGAGG - Intergenic
1062588480 9:137262199-137262221 AGGCCCTCCACAAGAGGTGGAGG + Intronic
1062647967 9:137559451-137559473 AGGCCCTCCACAAGAGGTGGAGG - Intronic
1188212539 X:27442408-27442430 AGGCTCTCCACAACAGGTGGAGG + Intergenic
1197077946 X:122375597-122375619 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1198268278 X:135031270-135031292 AGCCCCTCCACACCTGTGGGAGG - Intergenic
1198287526 X:135206783-135206805 AGGCCCTCCACAACAGGTGGAGG - Intergenic
1198344714 X:135748094-135748116 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1198998676 X:142606694-142606716 AGGCCCTCCACAAGAGGTGGAGG + Intergenic
1201423534 Y:13825142-13825164 AGGCCCTCCACAAGAGGTGGAGG - Intergenic