ID: 1069741622

View in Genome Browser
Species Human (GRCh38)
Location 10:70688829-70688851
Sequence CATGAGAGGGAGACCGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069741614_1069741622 -8 Left 1069741614 10:70688814-70688836 CCAGCTTCGGCTCCGCATGAGAG 0: 125
1: 119
2: 538
3: 536
4: 285
Right 1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG No data
1069741612_1069741622 13 Left 1069741612 10:70688793-70688815 CCGAGATGGCAGCAGTACAGTCC 0: 791
1: 492
2: 154
3: 345
4: 7246
Right 1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069741622 Original CRISPR CATGAGAGGGAGACCGGAGG GGG Intronic
No off target data available for this crispr