ID: 1069741926

View in Genome Browser
Species Human (GRCh38)
Location 10:70690372-70690394
Sequence TCTCCTCTGCAAAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 2, 2: 3, 3: 47, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069741926_1069741936 15 Left 1069741926 10:70690372-70690394 CCTTCCACCCTTTGCAGAGGAGA 0: 1
1: 2
2: 3
3: 47
4: 246
Right 1069741936 10:70690410-70690432 TGGAGGGTCATTGTGTCATCAGG No data
1069741926_1069741933 -1 Left 1069741926 10:70690372-70690394 CCTTCCACCCTTTGCAGAGGAGA 0: 1
1: 2
2: 3
3: 47
4: 246
Right 1069741933 10:70690394-70690416 ACTGGCCAGTGATACCTGGAGGG No data
1069741926_1069741931 -5 Left 1069741926 10:70690372-70690394 CCTTCCACCCTTTGCAGAGGAGA 0: 1
1: 2
2: 3
3: 47
4: 246
Right 1069741931 10:70690390-70690412 GGAGACTGGCCAGTGATACCTGG No data
1069741926_1069741937 27 Left 1069741926 10:70690372-70690394 CCTTCCACCCTTTGCAGAGGAGA 0: 1
1: 2
2: 3
3: 47
4: 246
Right 1069741937 10:70690422-70690444 GTGTCATCAGGAGCCACTTGTGG No data
1069741926_1069741938 28 Left 1069741926 10:70690372-70690394 CCTTCCACCCTTTGCAGAGGAGA 0: 1
1: 2
2: 3
3: 47
4: 246
Right 1069741938 10:70690423-70690445 TGTCATCAGGAGCCACTTGTGGG No data
1069741926_1069741939 29 Left 1069741926 10:70690372-70690394 CCTTCCACCCTTTGCAGAGGAGA 0: 1
1: 2
2: 3
3: 47
4: 246
Right 1069741939 10:70690424-70690446 GTCATCAGGAGCCACTTGTGGGG No data
1069741926_1069741932 -2 Left 1069741926 10:70690372-70690394 CCTTCCACCCTTTGCAGAGGAGA 0: 1
1: 2
2: 3
3: 47
4: 246
Right 1069741932 10:70690393-70690415 GACTGGCCAGTGATACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069741926 Original CRISPR TCTCCTCTGCAAAGGGTGGA AGG (reversed) Intronic
900230566 1:1554886-1554908 TCTCCTTTGCAAACCGTGGCTGG + Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900495520 1:2974318-2974340 CCTCCTGTGCCATGGGTGGAGGG - Intergenic
900555419 1:3278003-3278025 TCTCATCTGAAAAGGAGGGAGGG + Intronic
900708984 1:4099413-4099435 TCACCTCTTCACAGGGTGGCAGG - Intergenic
900964166 1:5945957-5945979 TCTCAACTGCAATGGGTGGGTGG - Intronic
901717544 1:11168575-11168597 AGCCTTCTGCAAAGGGTGGAAGG - Intronic
902918214 1:19651374-19651396 TGTGCACTGGAAAGGGTGGAAGG + Intronic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903193006 1:21667344-21667366 TCTTGTCTCCTAAGGGTGGAAGG + Intronic
903547708 1:24137034-24137056 TCCCCTCTGGAGTGGGTGGAGGG - Intronic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
903850363 1:26302014-26302036 TCTGCTCTGCAAAGGCTGTGAGG + Intronic
904927627 1:34061121-34061143 TCTTCTCTGCAATGGGGAGAGGG + Intronic
905873635 1:41418745-41418767 ACTCCTCTGCTGGGGGTGGAGGG + Intergenic
905998643 1:42404151-42404173 TCCCCTCTTCTAAGTGTGGAAGG - Intronic
907572724 1:55498691-55498713 TCCACTTTGCAAAGGATGGAAGG - Intergenic
907649879 1:56285105-56285127 CCTCCTCTGCAAAGGGTTGTTGG - Intergenic
907699558 1:56771484-56771506 TTGCCTCTGCAAAGGGAGAAAGG + Intronic
910011716 1:82471871-82471893 TCCCCTCCGCAGAGGTTGGAAGG + Intergenic
910207676 1:84764419-84764441 TCTCCACTGCCAAGGGACGAGGG + Intergenic
910432083 1:87168648-87168670 ATTCAACTGCAAAGGGTGGATGG - Exonic
911160973 1:94683201-94683223 TCACCTCTGCAGAGGATAGAAGG + Intergenic
911488414 1:98531295-98531317 TCACCTCTTCACAGGGTGGCAGG + Intergenic
912225048 1:107723692-107723714 GCTCCTCTGTATAGGGTGGCTGG - Intronic
913570588 1:120115977-120115999 GCATCTCTCCAAAGGGTGGAAGG + Intergenic
914885345 1:151580016-151580038 GCTCCTTTGCAAAGCCTGGAGGG - Intronic
916426430 1:164685563-164685585 TTTCCCCTGCAAAGGGAAGAGGG + Intronic
917307373 1:173640321-173640343 CCTTCTCATCAAAGGGTGGAAGG + Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
921437801 1:215147270-215147292 TTTCTTCTGGAAAGGGAGGATGG - Intronic
923104853 1:230846576-230846598 TCTCATCTCCCAAGGCTGGAGGG - Intronic
924384758 1:243490590-243490612 TCTCCTCTGCACAGTGGGCATGG + Intronic
1062811582 10:470446-470468 TCACCTCTTCAAAGGCAGGAAGG - Intronic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1063408302 10:5816807-5816829 TCTCCTTTTCAAAGGGCAGATGG - Intronic
1063988977 10:11539051-11539073 TCTCCTCTCCAAGGGGCAGAAGG + Intronic
1064151364 10:12868453-12868475 TGGCCTCTGCAAAGGGAGAATGG - Intergenic
1065476704 10:26146021-26146043 TCTCTTCTTGAAAGGGAGGAGGG - Intronic
1066180798 10:32958572-32958594 CCTCCTCTGCGAAGGGCGGGAGG + Intronic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1067321219 10:45223032-45223054 TCTCCTCTTCAAAAGCTGAAGGG + Intergenic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1070753822 10:78979378-78979400 CATCCGCTGGAAAGGGTGGAAGG - Intergenic
1070992563 10:80745368-80745390 CGTCCTCATCAAAGGGTGGAAGG + Intergenic
1072627752 10:97124487-97124509 TCTCCTCTGCGGAGGCTGCAGGG + Intronic
1073149554 10:101302490-101302512 TCTCCTGTGCATCGGGTAGAGGG + Intergenic
1073265570 10:102226415-102226437 ACTCCTGGGCAAAGGGAGGAGGG - Exonic
1074114513 10:110445746-110445768 TCTCCCCTGCAATGGGGTGAGGG + Intergenic
1075372568 10:121950357-121950379 TTTCCTCTGTAAAGGCAGGAAGG + Intergenic
1075586883 10:123665027-123665049 TCCCCTCAGCAAAGTGTGCAGGG - Intergenic
1076370595 10:129950271-129950293 CATCCTCTGCAAACGGTGGTGGG - Intronic
1077018958 11:409088-409110 TCCCCTCAGCACAGGGTGGGCGG - Intronic
1078131492 11:8617848-8617870 TATCCTCTTCAGAGTGTGGATGG - Exonic
1080752587 11:35164693-35164715 TCTCCTCTGCAGAGTGAGCAAGG + Intronic
1081129703 11:39363892-39363914 TCTCCTAAGAACAGGGTGGAAGG - Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081502076 11:43676856-43676878 TCTCCTTAGAATAGGGTGGAAGG - Intronic
1081575097 11:44314222-44314244 CCAGCTCTGCAAATGGTGGAAGG + Intergenic
1081575652 11:44317203-44317225 ACCGATCTGCAAAGGGTGGACGG - Intergenic
1081803112 11:45873109-45873131 TCTCCTTTCCCAAGGGAGGAAGG + Intronic
1082036737 11:47651186-47651208 TCTCCTCTGGAAACTGCGGAAGG - Intergenic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1084461604 11:69299445-69299467 TCTCCCCTGCTAAGGGGGGTTGG - Intronic
1088423799 11:109678109-109678131 TCCCTTGTGCAAAGGGTGAAAGG - Intergenic
1090223944 11:125057549-125057571 TCTACTCTGCCAGGGGTGGCGGG + Intergenic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1091374914 12:18853-18875 TCGCCTCTGCAGAGGGGGAATGG + Intergenic
1091650768 12:2307495-2307517 ACTTCTCTGCAAAGGGTGCTGGG + Intronic
1092169147 12:6362498-6362520 CCTCCCCTGCCTAGGGTGGAAGG + Intronic
1092253803 12:6915629-6915651 TCTCCTCTTCCCAGGGGGGAGGG + Exonic
1096491291 12:52014623-52014645 TGGCCTCTGCAAAGGGTCGGAGG - Intronic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1100136132 12:91555852-91555874 GCTGCTCTGCAAAAGGTGGGAGG + Intergenic
1100804212 12:98263993-98264015 TCTCCTCTGCAAGCAGAGGAAGG + Intergenic
1101702135 12:107184027-107184049 TTTCATCTGCTAAGGCTGGATGG + Intergenic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1103193566 12:119023195-119023217 TTTCTTCTGCAAAGGGAGCAAGG - Intronic
1103300320 12:119921308-119921330 TTTTCTCTGCATAGGGTGGAAGG - Intergenic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105002630 12:132701233-132701255 TTTCCCCTGCAAAGGAGGGAAGG - Exonic
1105597699 13:21854909-21854931 TTTCCTCTGCAAAAGGTTGAAGG - Intergenic
1106486585 13:30178342-30178364 CCTCCTCTGCAAAGGGTTCCAGG - Intergenic
1106756526 13:32827860-32827882 TCTCCTCTGCAAAGGCAGACTGG + Intergenic
1108007898 13:45970964-45970986 TCTCATCTGAAAATGGTGGGTGG + Intronic
1108572989 13:51768782-51768804 TCTGCAGTGCAAAGGGTGTAAGG - Intronic
1109632833 13:65075462-65075484 TTTCCCATGCAAAGGGTGCATGG + Intergenic
1109672793 13:65632171-65632193 TTTTCTATGAAAAGGGTGGAGGG - Intergenic
1109713009 13:66183526-66183548 TCTCCTCAGGCAAAGGTGGAAGG + Intergenic
1112238031 13:97653658-97653680 GCTCCTCTGCAAAGGGCTCAGGG + Intergenic
1112839901 13:103563453-103563475 TCACCTCTGCACAGGGTAGCAGG + Intergenic
1114984129 14:28205824-28205846 ACGCCTCTTCAAAGGGTGGCAGG + Intergenic
1115328114 14:32165172-32165194 TCTCCTCTACACAAGATGGATGG - Intergenic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1118921096 14:70150671-70150693 TTTCCTCTGCAAAGAGAGGCAGG - Intronic
1120618203 14:86733133-86733155 TTTCCTCTTAAAAAGGTGGATGG + Intergenic
1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG + Intergenic
1122094130 14:99358935-99358957 TCTTCTCTGTAAAGTGAGGAAGG - Intergenic
1122444429 14:101759064-101759086 TCTCCACAGCAACGGGGGGAAGG - Intergenic
1122801906 14:104235221-104235243 GCACCTCTTCACAGGGTGGAAGG - Intergenic
1127886275 15:63203979-63204001 TCTTCTCTGCAGAGGGTTGTCGG + Intronic
1128613815 15:69094197-69094219 TATCCTCTGGAAATGGTGGTCGG + Intergenic
1129329204 15:74818225-74818247 TCTCTTCTGCCAAGGGAGCAGGG + Intronic
1130063508 15:80586539-80586561 TCTCCTCTCCAAAGTGAGTATGG - Intronic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1138518561 16:57555411-57555433 GCACCTCTTCAAAGGGTGGCAGG - Intronic
1139406006 16:66718183-66718205 TATCCTCTACAAAGGGAGAAGGG - Intergenic
1139947948 16:70654435-70654457 TCTCCTATGCAAATGGATGATGG + Intronic
1140119377 16:72070403-72070425 TGTCCTCATAAAAGGGTGGAAGG + Intronic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1142027632 16:87823044-87823066 TGACCTCTGCAAAGGCTGGCTGG - Intergenic
1147304945 17:39556730-39556752 TCTCCTATCCATAGGGTAGATGG + Intronic
1147551746 17:41448023-41448045 TCTCATCTGCAATGAGAGGAGGG + Intergenic
1147595624 17:41715415-41715437 TCTCGTCTGCAAAGGGGAGAAGG - Exonic
1149047539 17:52265350-52265372 TCTCATCTGCAATGGGAGTATGG - Intergenic
1149470003 17:56908752-56908774 TGTCCTCTGAAAAGGATGAAGGG - Intronic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1153413380 18:4818745-4818767 TTTCCTCAGCAAAAGGAGGAAGG - Intergenic
1155170823 18:23265763-23265785 TCCCCACTGGAGAGGGTGGATGG + Intronic
1155311954 18:24532787-24532809 TCTCCTCTCCAAAGTGGAGAGGG - Intergenic
1157335544 18:46734553-46734575 TCTCCTCTGCAGAGGCTCAAAGG - Intronic
1160564715 18:79779954-79779976 TCACCTGTGCAAAGTGTGGGCGG + Intergenic
1161043136 19:2120672-2120694 TCGCCTCTGTAAAGGGGGAATGG + Intronic
1162243141 19:9374133-9374155 TCTCTTCGGCAAATGGTGTAAGG - Intronic
1163132795 19:15286206-15286228 TCTCATCTGCTCGGGGTGGAGGG - Intronic
1163522445 19:17799570-17799592 CCTCCTCTGCAAAGCTGGGATGG - Intronic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1167632281 19:50632524-50632546 GCAGCTCAGCAAAGGGTGGATGG + Exonic
1167719203 19:51167258-51167280 CCGCCTCTGCACAGAGTGGAGGG - Intergenic
1168406197 19:56111871-56111893 CCTCCTCTGCAAAGCAGGGACGG + Intronic
1168692465 19:58385421-58385443 GCTACTCTGCACAGGATGGAGGG + Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930295483 2:49548098-49548120 TCTCCTCAGACAAAGGTGGAAGG + Intergenic
930877213 2:56232578-56232600 GCACCTCTTCACAGGGTGGAAGG - Intronic
932128976 2:69170262-69170284 TCTCCTCGGCAGGGGGTGGAGGG - Exonic
935061703 2:99614252-99614274 TCTCCTCTGCTAAATGTGGCAGG - Intronic
935127146 2:100234671-100234693 TCTCATCTGCAACGTGTGGTTGG + Intergenic
935925972 2:108068769-108068791 TCTCCTCTGCAAAGTGCGGGTGG + Intergenic
937200905 2:120204051-120204073 TCTGCTCTAGAGAGGGTGGAAGG + Intergenic
937262359 2:120594723-120594745 TCTCTGTTGCAGAGGGTGGAGGG + Intergenic
941965292 2:171294823-171294845 TCTTCTCTGCCCAGGGTGGTGGG + Intergenic
943112561 2:183623844-183623866 TCTCCTCGGCAAAGAGAGGCAGG - Intergenic
946455968 2:219826441-219826463 TCCCCTCTGCTAAGGATGGGAGG + Intergenic
946652964 2:221913926-221913948 TCTCCTGTGCACTGGGAGGATGG - Intergenic
947048600 2:226017695-226017717 TCACCTCTTCACAGGGTGGTAGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1170743213 20:19075762-19075784 TCTCCTTTGCAATGCCTGGAAGG + Intergenic
1170935104 20:20803129-20803151 TCTCCTTGGCCAAGGGTGGTGGG - Intergenic
1172196914 20:33098132-33098154 TCTCCTCTGCCACAGGGGGATGG + Intronic
1173353008 20:42262223-42262245 TCCCCTCCCCAAAGGATGGATGG + Intronic
1173837079 20:46132884-46132906 TCTCCTCTTCCAAGTGTGGGCGG - Intergenic
1173949261 20:46977704-46977726 TTTCCTTTGCAAAGGCTAGAAGG - Intronic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174732013 20:52927270-52927292 TCTCCAGTACAAAGGGAGGAAGG - Intergenic
1175202739 20:57289385-57289407 TCTACTCTGCATGGGGTGGGGGG - Intergenic
1175296820 20:57914202-57914224 TCACCTCTGCAGAGGGATGATGG - Intergenic
1175572385 20:60033851-60033873 TTTCCTCTGCAAACTGTGGATGG + Intronic
1175696472 20:61106492-61106514 TCTGCTCAGGGAAGGGTGGAAGG - Intergenic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179588598 21:42390122-42390144 ACTTCTCTGCAAAGAGGGGAGGG - Intronic
1179831573 21:44000400-44000422 TGATCTCTGCAAAGGGAGGAGGG + Intergenic
1180689147 22:17696646-17696668 TGTCTTCTGCAAAGGATGGTTGG - Intronic
1181165307 22:20980003-20980025 TCGCCTCTGCAAGGAGAGGATGG - Exonic
1181349159 22:22243212-22243234 CCTCCTCTGCACAGGCTGGTGGG - Intergenic
1181628940 22:24140372-24140394 TCCCCTCTGCTCAGGGAGGACGG - Intronic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1182369378 22:29800198-29800220 TCACTTCTGCAAAGGAGGGAAGG - Intronic
1183389710 22:37538579-37538601 CCTCTTCTGTAAAGGGGGGAAGG - Intergenic
1183452742 22:37905882-37905904 TCCCGCCTCCAAAGGGTGGAGGG + Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184562829 22:45273359-45273381 TCTCCTCTGTAAAGCGGGGGTGG + Intergenic
1185206067 22:49539572-49539594 TTTCCTCTGCAGAGACTGGAAGG - Intronic
1185282231 22:49977841-49977863 CCTGCTCTGCAAAGGGCGGCAGG - Intergenic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
951072735 3:18351377-18351399 TCTCCTTTCCCAAGGGTGGTGGG + Exonic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
954961868 3:54572564-54572586 TCTGCTCAGGAAAGGGTGCAAGG - Intronic
959063558 3:101636309-101636331 TCTCGTCTGCAAAGGGGAAAGGG - Intergenic
959840278 3:110967180-110967202 TGTTCTCATCAAAGGGTGGAAGG - Intergenic
961293453 3:125865502-125865524 TTTCCTCTGAAAAAGGTGGCTGG + Intergenic
962630016 3:137266022-137266044 TCTCCTCAGTAAAGGGTTTATGG - Intergenic
963310640 3:143706668-143706690 TCTCCTCTGTAAGGGGTGGAGGG + Intronic
964411485 3:156402540-156402562 TCTGTTCTGCAAAGGGAGAAAGG - Intronic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
967005422 3:185378440-185378462 TTTCCTCTTTAAAGGGTGGCTGG - Intronic
967092010 3:186142826-186142848 TCTACTCTGGAATGGGTGGGGGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967813454 3:193779999-193780021 GCCCCTCTGCGATGGGTGGAAGG + Intergenic
969192160 4:5531067-5531089 GCTCCTCTGCAAAGTTGGGAGGG - Intergenic
969455375 4:7297139-7297161 TCTCCTCTGCATTAGGTGGAGGG + Intronic
969619770 4:8273191-8273213 TTTCCTCTGCAAGGGGTGGCAGG + Intronic
969627565 4:8315468-8315490 TCTCCTCAGCAATGGCAGGAAGG - Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
973801666 4:54484463-54484485 TCTCATCTGCATGGGGTGGTTGG - Intergenic
974679163 4:65138245-65138267 TCACCTCTTTAAAGGGTGGCAGG + Intergenic
975920069 4:79375218-79375240 TCACTTGTGCAAAGGTTGGATGG - Intergenic
977749439 4:100591360-100591382 TCTACTCTCCAAAGGATGGAGGG - Intronic
981383830 4:144103858-144103880 TCACCTCTTCACAGGGTGGCAGG + Intergenic
983116655 4:163825937-163825959 TCTGCTCTGCACTGGGTGTAGGG - Intronic
985944257 5:3164220-3164242 TCTCTTCTGCAAATGGTTGAGGG + Intergenic
986167865 5:5291523-5291545 TCTCCTCCGCAAAGGGGAGATGG - Intronic
988848742 5:35157460-35157482 TCTGCTCTGTTAAGGGAGGAGGG - Intronic
989049174 5:37301931-37301953 TATCTTCAGCAGAGGGTGGAAGG - Intronic
990519708 5:56567035-56567057 TCTCCTCTGTGAAGGATGTACGG + Intronic
990797039 5:59555188-59555210 TGTCCTCTGCAAAACGTGGATGG + Intronic
992912292 5:81407908-81407930 GCTCCTCTTCACAGGGTGGCAGG + Intergenic
993079322 5:83275765-83275787 TCTCTTCAGCAATGTGTGGATGG + Intronic
993909023 5:93658041-93658063 TTTCCTCTGTGAAGGCTGGATGG + Intronic
994807386 5:104467517-104467539 TCTCCTCAGCAAATGGTGCTGGG - Intergenic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1005898341 6:30196777-30196799 ACACCTCTGCTCAGGGTGGAGGG + Intronic
1007024253 6:38553626-38553648 TCTCTTTTCCCAAGGGTGGAAGG - Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007752796 6:44080598-44080620 CCCCCTCTGGAAAGGGTTGATGG - Intergenic
1009187450 6:60589986-60590008 TCATCTCTGCACAGAGTGGATGG - Intergenic
1011844863 6:91551400-91551422 TCACCTCTTCACAGGGTGGCAGG + Intergenic
1013058096 6:106604773-106604795 TACCCTCTTCATAGGGTGGAGGG - Intronic
1014444627 6:121513022-121513044 TCCCCTCTTCACAGGGTGGCAGG - Intergenic
1016309264 6:142715627-142715649 TTTCCTCTGCAAATGATGGATGG + Intergenic
1018211511 6:161487209-161487231 TCTCCTGTAAAAAGGGTTGAGGG - Intronic
1020400842 7:7775462-7775484 GCACCTCTTCAAAGGGTGGCAGG - Intronic
1021393564 7:20122380-20122402 TCTCCTCTTAAAAAGGTGGCTGG + Intergenic
1022086047 7:27068649-27068671 TCTTCTCTGAAAAGTGTGGAGGG - Intergenic
1022177403 7:27885006-27885028 TCTGCTCTGCACAGGAAGGAGGG + Intronic
1022459714 7:30594096-30594118 CCTCCTGCCCAAAGGGTGGAGGG - Intergenic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1027346306 7:77263190-77263212 GCTCAACTGCAAAGGGTGCAAGG - Intronic
1027716231 7:81674241-81674263 TCTGCTCTGAAAAGGAAGGAAGG + Intergenic
1027793930 7:82668410-82668432 CCTCCTCTTCACAGGGTGGCAGG + Intergenic
1031516242 7:122702533-122702555 TCTCCTCTGGAAAGGGTGTCTGG - Exonic
1034485869 7:151361851-151361873 TCTCTTCTGCAAACAGTGTAGGG + Intronic
1035875659 8:3186695-3186717 TCTCTACTGCAAAGGGAGGCTGG - Intronic
1037519141 8:19662778-19662800 TCTCCACTGCTCAGAGTGGATGG - Intronic
1037890025 8:22619133-22619155 TCTCCTCTGCAAGGTGGAGAAGG - Exonic
1038346840 8:26740846-26740868 ACACCTCTTCAAAGGGTGGCAGG - Intergenic
1038346912 8:26741289-26741311 GCTCCTCTGGGAGGGGTGGAGGG + Intergenic
1038613813 8:29075403-29075425 TTTCCGCTGCACAGGCTGGAGGG + Intronic
1039473737 8:37828732-37828754 TCTCCTCAGCACCGGGTGGGAGG - Intronic
1042224380 8:66504138-66504160 TCTTCTCTGCACAGTGGGGAGGG - Intronic
1044521780 8:93206992-93207014 TTTCTTCTGCAAATGTTGGAGGG - Intergenic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1048728480 8:137412194-137412216 TTTCCTCTGAAAAAGGTGGCTGG - Intergenic
1050480795 9:6085176-6085198 TGTCCTCATCAAAGGGTGGAAGG + Intergenic
1051953458 9:22662437-22662459 TATCCTCTTAAAAAGGTGGATGG - Intergenic
1055127317 9:72733560-72733582 TCCCCTCTGATAAGGGTGGACGG - Intronic
1055446539 9:76389339-76389361 TCTCGTCTGTAATGGGTGGGGGG + Intronic
1056600738 9:88044807-88044829 TCTGCTGAGCAATGGGTGGATGG - Intergenic
1057217553 9:93237809-93237831 GGTCCTCAGCAAAGGCTGGAGGG + Intronic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1057947078 9:99338916-99338938 TCTCCTCTGCCTTTGGTGGATGG + Intergenic
1058281353 9:103119449-103119471 TCTCCTCTTCACAGGATGGCAGG + Intergenic
1061808946 9:133151442-133151464 TGTGCTCTGCACAGGGTGGGAGG - Intergenic
1185719922 X:2373334-2373356 TCTCCTCTGAAAAGAGTGTGAGG - Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1188735878 X:33715125-33715147 GCACCTCTTCAAAGGGTGGCAGG + Intergenic
1188838546 X:34987741-34987763 TCTCCTGTGAAAAGGGAGAAAGG - Intergenic
1192184252 X:68935919-68935941 TCACCTGTAAAAAGGGTGGAGGG + Intergenic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1195382592 X:104284833-104284855 GCTGCTCTGCAAAGGGGAGATGG + Intergenic
1195608490 X:106836185-106836207 GCACCTCTTCACAGGGTGGAAGG + Intronic
1196442408 X:115728636-115728658 TTTCCTCAGCAAAGGGCGGAGGG - Intergenic
1196443149 X:115732268-115732290 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196443808 X:115735236-115735258 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196444365 X:115737655-115737677 TTTCCTCAGCAAAGGGCGGAGGG - Intergenic
1196445470 X:115844183-115844205 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196446141 X:115847164-115847186 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196446812 X:115850145-115850167 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196447480 X:115853128-115853150 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196448151 X:115856107-115856129 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196448820 X:115859098-115859120 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196449491 X:115862089-115862111 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196450160 X:115865072-115865094 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196450830 X:115868057-115868079 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196451501 X:115871036-115871058 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196452172 X:115874023-115874045 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196452842 X:115876992-115877014 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196453512 X:115879985-115880007 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196454181 X:115882994-115883016 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196454848 X:115885983-115886005 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196455262 X:115888065-115888087 TTTCCTCAGCAAAGGGCGGAGGG + Intergenic
1196456197 X:115893152-115893174 TTTCCTCAGCAAAGGGTGGAGGG - Intergenic
1196456372 X:115894266-115894288 TCTCCTCAGCAAAGGGTGGAGGG - Intergenic
1196456724 X:115896153-115896175 TTTCCTCAGCAAAGGGCAGAGGG - Intergenic
1196457151 X:115898760-115898782 TTTCCTCAGCAAAGGGCGGAGGG - Intergenic
1196461899 X:115940968-115940990 TTTCATCCACAAAGGGTGGAGGG + Intergenic
1196463260 X:115950274-115950296 TTTCCTCTGCAAAGGGTGGAGGG - Intergenic
1196463809 X:115953145-115953167 TTTCCTCATCAAAGGGTGGAGGG - Intergenic
1198412999 X:136390670-136390692 CCTACAGTGCAAAGGGTGGAAGG + Intronic
1199627414 X:149753152-149753174 TCTCCTCAGACAAAGGTGGAAGG + Intergenic