ID: 1069746438

View in Genome Browser
Species Human (GRCh38)
Location 10:70717730-70717752
Sequence GCTTCTGGCTGCAACCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069746438_1069746446 25 Left 1069746438 10:70717730-70717752 CCAGCCAGGTTGCAGCCAGAAGC 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1069746446 10:70717778-70717800 CTCTTGGCAGCCAGCCTGTCTGG No data
1069746438_1069746442 9 Left 1069746438 10:70717730-70717752 CCAGCCAGGTTGCAGCCAGAAGC 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1069746442 10:70717762-70717784 GTTTCCTCTAGAAACCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069746438 Original CRISPR GCTTCTGGCTGCAACCTGGC TGG (reversed) Intronic
900082603 1:869860-869882 GCTTCGCGCTGCCGCCTGGCTGG + Intergenic
900436570 1:2633906-2633928 GCTTCGAGCTGCAGCCAGGCTGG + Intergenic
900640814 1:3687322-3687344 GCTTCTGGATGCCACCTGGGTGG + Intronic
901801784 1:11712422-11712444 GGTGCTGGCTGGTACCTGGCAGG - Exonic
901937209 1:12635165-12635187 GCATCTCGCTGCAAACTGGGAGG + Intergenic
902408237 1:16198247-16198269 CCTTCTGGCAGGGACCTGGCTGG - Exonic
903994774 1:27298876-27298898 TCGTCTGGCTGCAACTCGGCAGG + Intronic
906722106 1:48015768-48015790 GCATATGAGTGCAACCTGGCAGG + Intergenic
908392898 1:63699425-63699447 GCTGATGGCTCCAACCTGCCTGG + Intergenic
909070045 1:70983173-70983195 GGTTCTGGCTGTCACCTGACAGG - Intronic
910480990 1:87658169-87658191 GATTCTGGCAGCAGCCTAGCAGG - Intergenic
910867164 1:91799156-91799178 GCTTCTGGGTGCAGACTGGCTGG - Intronic
912386737 1:109274565-109274587 CCTTCAGGCTGCACCCGGGCAGG + Exonic
914218522 1:145656219-145656241 GCTGCTGGCTGCAACCTCAGTGG + Intronic
914471081 1:147978910-147978932 GCTGCTGGCTGCAACCTCAGTGG + Intronic
915013051 1:152707928-152707950 GCCTCTGGCTGAAATTTGGCTGG + Intergenic
915529440 1:156494843-156494865 GCTTCTGCTTACAACCTGGATGG + Intronic
918128876 1:181607830-181607852 GTTTCAGGCAGCATCCTGGCAGG + Intronic
922337733 1:224631394-224631416 GCTTCTCTGGGCAACCTGGCTGG + Intronic
922674621 1:227542748-227542770 GCTTCGCGCTGCCGCCTGGCTGG - Intergenic
924904865 1:248441608-248441630 GATTGTGGCGGCAGCCTGGCTGG + Exonic
924923022 1:248650434-248650456 GATTGTGGCGGCAGCCTGGCTGG - Exonic
1065311030 10:24416014-24416036 GCTTCAGGCTGCAGTCAGGCTGG + Intronic
1067779539 10:49189672-49189694 GCCTCTGGCTGGACCTTGGCAGG - Intergenic
1069746438 10:70717730-70717752 GCTTCTGGCTGCAACCTGGCTGG - Intronic
1070160372 10:73863256-73863278 TCTCCTGGCTGCATCCTGGTCGG - Intronic
1072393368 10:95012976-95012998 GCTTTTTGCAGCAACCTGGAAGG - Intergenic
1073563602 10:104517309-104517331 GCTCTTGGGTGCAGCCTGGCTGG + Intergenic
1074703664 10:116113119-116113141 GCATCTGGCTGGAAGGTGGCTGG - Intronic
1075944529 10:126421084-126421106 GTTTCTGGCTGCATTCTGGCAGG + Intergenic
1077518365 11:3016056-3016078 GCTTCTGGCTGAAACAGAGCTGG - Intronic
1078869013 11:15326902-15326924 GCTTCTGGCTCTAACCTGGCTGG + Intergenic
1080933395 11:36837270-36837292 GCTTCTGGCTGAACTCTGCCAGG - Intergenic
1081314238 11:41612097-41612119 GCTTCTGACTGCTACCTTGTGGG + Intergenic
1083897255 11:65626091-65626113 GGCTCGGGCTGCAGCCTGGCTGG + Intronic
1084814658 11:71639220-71639242 CCATCGGGGTGCAACCTGGCTGG + Intergenic
1085342560 11:75742907-75742929 CCTTCTGGCTGCAAAGTGGAGGG - Intergenic
1085459874 11:76687075-76687097 GGGTCTCGCAGCAACCTGGCTGG + Intergenic
1085634511 11:78148013-78148035 GCTTCATGCTGGGACCTGGCTGG + Intergenic
1088904919 11:114148037-114148059 GCTTCTGGCTGCTACGTAACCGG - Intronic
1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG + Intronic
1089978658 11:122754511-122754533 GCTTGAGGCTGCCACCTGGAAGG + Intronic
1090575616 11:128099623-128099645 GCTGCTGTGTGTAACCTGGCTGG + Intergenic
1090957566 11:131526979-131527001 GCTCCTGGCTGCAACATGGGGGG - Intronic
1092428333 12:8390796-8390818 CCATCGGGGTGCAACCTGGCTGG - Intergenic
1092429416 12:8396948-8396970 CCATCGGGGTGCAACCTGGCTGG - Intergenic
1094165224 12:27436432-27436454 GTTCCTGGCTGCATTCTGGCAGG - Intergenic
1098465083 12:70777696-70777718 CCTTCTGTCTGCAAGCTGGATGG + Intronic
1098951705 12:76646032-76646054 TGTTCTAGCTGCAGCCTGGCAGG + Intergenic
1100365474 12:93916446-93916468 TCTTCTTGCTGCATCCTGTCAGG - Intergenic
1102036210 12:109771874-109771896 GGTTCCGGCTGCACCCAGGCGGG - Intergenic
1104135190 12:125931082-125931104 GCTTCTGGCTGAAAGCTTACAGG + Intergenic
1108497098 13:51035871-51035893 GCTTGTGGGTGCATCCTGGCCGG + Intergenic
1113417359 13:110138566-110138588 GCTTCCGGGTGCGCCCTGGCCGG - Intergenic
1114323954 14:21570291-21570313 GCTTGTGGCTGGAGCCTGGATGG - Exonic
1118739891 14:68731610-68731632 GCCTCTGGTTGCATCCTGGGGGG - Intergenic
1119475161 14:74922881-74922903 CCTCCTGGCCGCATCCTGGCCGG - Intronic
1120608184 14:86605480-86605502 GCTTCTGGCAGCAAGCTCTCTGG - Intergenic
1124407486 15:29404982-29405004 GTACCTGGCTGCCACCTGGCAGG + Intronic
1125352157 15:38779300-38779322 ACTTCAGGCTGCAGCCTCGCAGG + Intergenic
1126210440 15:46095152-46095174 TTTCCTGACTGCAACCTGGCAGG - Intergenic
1127842882 15:62845873-62845895 GCTCCTGGCTGCCTCCTTGCCGG - Intergenic
1128320689 15:66691776-66691798 GCTTCAGGCTGCATCCAGCCTGG - Intergenic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1128748302 15:70130415-70130437 GATTCTGGCATCAAGCTGGCTGG + Intergenic
1128797957 15:70478703-70478725 GCTTCTGGCTGAGCCCTGGGTGG + Intergenic
1130021213 15:80233488-80233510 CCTTCAGGCTGCAAACTGCCTGG + Intergenic
1132495250 16:260100-260122 CCTTCTGCCTGCATCCTGGTGGG + Exonic
1132806255 16:1776424-1776446 GCTTCTGGCTGGCAGATGGCTGG + Intronic
1133369883 16:5239557-5239579 CCATCGGGGTGCAACCTGGCTGG + Intergenic
1137256231 16:46777849-46777871 GCTCCTGGCTCCAACTTAGCAGG - Intronic
1137392255 16:48091551-48091573 GCCCCTTGCTGCCACCTGGCAGG + Intronic
1138455009 16:57116080-57116102 GCTTCTCCCTCCAGCCTGGCCGG - Intronic
1139035557 16:62941921-62941943 GCTTCTCTCTGCAACCTCGCTGG + Intergenic
1139269155 16:65665886-65665908 GTCTCTGGCTGCACCCTGGAGGG - Intergenic
1141555552 16:84834507-84834529 GGTCCTGGCTGGAACCTGGTTGG - Intronic
1141619569 16:85229642-85229664 GCTTCTGGAGCCAACCTGCCTGG - Intergenic
1143121129 17:4607553-4607575 GCTCCTGGGGGCATCCTGGCTGG - Exonic
1143210588 17:5184470-5184492 GCTCCAGCCTGCACCCTGGCGGG - Intronic
1143609722 17:8011039-8011061 GCGTGTGCCTGCAACCTGGCCGG - Intronic
1143683069 17:8492010-8492032 GCTCCAGCCTGCATCCTGGCAGG - Intronic
1145235130 17:21202674-21202696 GCTTCTCGCTGCTTCCAGGCTGG - Intronic
1146624673 17:34426246-34426268 GCTTCTCGCTGCAAGATGGAGGG + Intergenic
1147254638 17:39174602-39174624 GGTTCTGGGTGGAAGCTGGCAGG - Exonic
1147718195 17:42522013-42522035 GGTTCTGCCTGCAGCCTGCCTGG + Exonic
1148436850 17:47692263-47692285 GCATTTGGCTGCACCCTGCCAGG + Intergenic
1150268713 17:63848847-63848869 TCTGCTGGCTGCTCCCTGGCGGG - Intergenic
1151513415 17:74576894-74576916 GCTTGTGCCTTCATCCTGGCGGG + Intergenic
1152023254 17:77792839-77792861 GCTCCAGGCTTCTACCTGGCAGG - Intergenic
1153769591 18:8404796-8404818 GCCTCTGCCTGCCACCTGGCAGG - Intronic
1154497828 18:14975287-14975309 GCTTCTGGATGGAGCCTGCCTGG - Intergenic
1156997668 18:43486771-43486793 GCATCTGCCTGCAAGGTGGCAGG - Intergenic
1157553020 18:48594416-48594438 GCTCCTGACTGCCACGTGGCAGG + Intronic
1158294456 18:55979502-55979524 ACTTCTGTCTGCAAGCTGGAGGG - Intergenic
1158627854 18:59087304-59087326 ACTCCTGGCTGCAAGCTGGGAGG + Intergenic
1160247318 18:77169269-77169291 GCTGCTGGCTGCCACCTGTGAGG + Intergenic
1160953280 19:1677795-1677817 CCTTCTGCCTGCAACCTGGAGGG - Intergenic
1161805442 19:6440714-6440736 GGTCCTGGCTGCAACCTGCACGG - Exonic
1162492691 19:11003219-11003241 GCTCCTGGCTGCCACCTCCCTGG - Intronic
1162965180 19:14152149-14152171 TCTTCTGGCTGCCACCTGCAGGG - Exonic
1162974084 19:14198443-14198465 GCTTCTGGCCCCCACCTTGCTGG + Intronic
1163365194 19:16872110-16872132 GATTCTGGCAGAAACCAGGCAGG - Intronic
1164261190 19:23569873-23569895 CCCTCTGGCTGCAAGATGGCAGG - Intronic
1164913863 19:32034078-32034100 GCTCCTGGCTGCAGGGTGGCTGG - Intergenic
1166212570 19:41316559-41316581 GCTGCTGGCTGCAAACAGGCAGG - Exonic
1168670737 19:58239296-58239318 GCTACTGGCTGCAATCTGGTGGG - Intronic
927030897 2:19119503-19119525 GCTTCTGGCTGCCACATTTCAGG - Intergenic
931116140 2:59168914-59168936 GCTTCTGCCAGCACCCTCGCTGG - Intergenic
931824617 2:65987406-65987428 ACTTCTTGCTGCAAGATGGCTGG - Intergenic
932620206 2:73260637-73260659 GCTTGGGGCTGCAGCCTGGGTGG - Intronic
935109632 2:100080719-100080741 TCCTTTGGCTGCATCCTGGCCGG - Intronic
935264451 2:101382555-101382577 GCTTCTTGCTGTAACCTGGTGGG + Intronic
935332509 2:101987477-101987499 GCTTCTGGCTAGCACCTGGCAGG - Intergenic
936991585 2:118372631-118372653 GCTTTTGTCTGCAGCCTGGAGGG - Intergenic
941766588 2:169304022-169304044 CCTTCTGGCAAAAACCTGGCAGG - Intronic
942609776 2:177731450-177731472 TCTTCTGGCTGGAGCCTAGCGGG + Intronic
946321099 2:218955042-218955064 GTTTCTGGCAGCCACCTGCCTGG + Intergenic
948455257 2:238101780-238101802 GTTTCTGCCTGCAACATGGAGGG - Intronic
1170558691 20:17537164-17537186 GCTTCAAGCTGCACCCTGGTGGG - Intronic
1170606423 20:17878233-17878255 GGTTCTGGATGCAACCTTGTAGG + Intergenic
1171147990 20:22802560-22802582 GCTTCAGCATGCAACCTGTCAGG + Intergenic
1175641044 20:60630712-60630734 CCTTCCAGCTGCAACCTTGCAGG - Intergenic
1175844327 20:62050736-62050758 CCTTCTGCCTGGAGCCTGGCAGG - Intronic
1176020939 20:62962069-62962091 CCTTCTGGGTGCAACCTGGCTGG - Intronic
1176022758 20:62970526-62970548 GCTTCTGGGTGCCACCTCCCCGG + Intergenic
1176993135 21:15522258-15522280 GCTCCTGGCTGCAAAGGGGCAGG - Intergenic
1178478204 21:32956183-32956205 GTTTCTGGCTGGAGACTGGCAGG + Intergenic
1178588669 21:33891094-33891116 GCTGCTGGCATCACCCTGGCAGG + Exonic
1179575771 21:42307401-42307423 CCGTCTGGCAGCCACCTGGCAGG + Intergenic
1180596102 22:16974522-16974544 GCTTCTGGCTGCACAGAGGCTGG + Intronic
1181497298 22:23294809-23294831 GCTTCTGGAAGCATCCGGGCTGG + Intronic
1183056650 22:35310918-35310940 GCTACTGGCTGCTAGCTGGAAGG + Intronic
1183091838 22:35527556-35527578 GATTCTGGCTACAAACTGGTAGG - Intergenic
1183457852 22:37932501-37932523 GCTCCTGGCAGCAACCAGGCAGG + Intronic
1184085065 22:42256791-42256813 TCATCTGGCTGGAATCTGGCAGG + Intronic
1184672383 22:46021596-46021618 GCTGCTGGCTGCCACCTTGAAGG + Intergenic
1184973281 22:48043096-48043118 GCTGCTGGCAGGACCCTGGCAGG + Intergenic
950566905 3:13774831-13774853 GCCTCTGGCTGCCATCTGGAGGG + Intergenic
951707014 3:25553708-25553730 GGTCTTCGCTGCAACCTGGCAGG + Intronic
954378899 3:50209239-50209261 GCTTCTGACTGCAACCTCTATGG + Intronic
954402449 3:50326097-50326119 GCTTCTGTCTGCCACCTCCCAGG + Exonic
956305630 3:67821327-67821349 GTGTCTGGATGCAAGCTGGCTGG - Intergenic
957073036 3:75580507-75580529 CCATCGGGGTGCAACCTGGCTGG - Intergenic
960497686 3:118394848-118394870 GGTCCTGGCTGCAACCTGCACGG - Intergenic
961281047 3:125766270-125766292 CCATCGGGGTGCAACCTGGCTGG + Intergenic
961735548 3:129000502-129000524 GCCTCTTGCTCCAACATGGCTGG + Intronic
961873345 3:130003315-130003337 CCATCGGGGTGCAACCTGGCTGG - Intergenic
962087287 3:132205042-132205064 GCTTCAGGCTGAAAGTTGGCTGG + Intronic
965561271 3:170064287-170064309 GCTCATGGCTGCGACCTCGCAGG - Intronic
965768534 3:172156448-172156470 CCTTCAGGCAGCAACCTGCCTGG - Intronic
966928368 3:184660027-184660049 GCTTCTGGAGGCATCCGGGCGGG - Intronic
968641530 4:1717348-1717370 GCCTGTGGCTGCCTCCTGGCAGG + Exonic
968865360 4:3206962-3206984 GCTTCTGGCTGCAAATTTACAGG + Exonic
969116656 4:4874465-4874487 GCTGCTGCCTTCCACCTGGCAGG + Intergenic
969737316 4:9000511-9000533 CCATCGGGGTGCAACCTGGCTGG + Intergenic
969796520 4:9532099-9532121 CCTTCGGGGTGCAAACTGGCTGG + Intergenic
970726318 4:19049415-19049437 GCTTCAGGCTGCGGCTTGGCTGG + Intergenic
977039771 4:92001863-92001885 GCTGCTGGCTGCAACATGAGTGG - Intergenic
978168477 4:105638114-105638136 CCTTTTGGCTGCAACATTGCTGG - Intronic
979509692 4:121538202-121538224 GCTTTTGGCAGCAACTTGGATGG - Intergenic
990817712 5:59804323-59804345 GTCTCTGGCAGCAACTTGGCTGG - Intronic
992219774 5:74560305-74560327 GGTTCTGGCAGGAAACTGGCAGG + Intergenic
992442568 5:76809556-76809578 TCTTCCCTCTGCAACCTGGCAGG - Intergenic
993421056 5:87701168-87701190 GCTGCTGGCTGCAACCTGAGCGG + Intergenic
994622402 5:102178971-102178993 GGTTCTGGCTGGCATCTGGCAGG - Intergenic
995739752 5:115343217-115343239 GCTTCTGGCTGCTCCATGGCAGG - Intergenic
998853941 5:146376893-146376915 GCTTCTGGCTGAACCCTTGGAGG + Intergenic
1001255801 5:170182859-170182881 GCTTCTGGCTGCAATTTGCAAGG - Intergenic
1001419178 5:171573900-171573922 GCTTCTCCCTGCTCCCTGGCAGG - Intergenic
1002334420 5:178468213-178468235 GCTTCTGGCTGGAGTCTGGGTGG - Intronic
1002434550 5:179222648-179222670 GCCGCTGGCTGCTACCTGGAAGG - Intronic
1006171736 6:32097084-32097106 CCCTCTGGCTGCAACCTCGAGGG + Intronic
1006815251 6:36845538-36845560 GCATCTGTCTGCAACCTGGTGGG + Intergenic
1006984960 6:38169949-38169971 GCTTCTGACTGGAAGCTCGCTGG + Exonic
1007004398 6:38346848-38346870 GCTGCTGTCTGCAACCTTGGAGG + Intronic
1007710081 6:43817366-43817388 GCTCCTTGCTGCCCCCTGGCAGG + Intergenic
1008753082 6:54760412-54760434 GTCTTTGGCTGCAACATGGCAGG + Intergenic
1012128941 6:95466942-95466964 GCTCCTGGCTGCATCCTCACAGG - Intergenic
1018581045 6:165308572-165308594 GCTTCAGGCTGTCACCAGGCTGG - Intronic
1019403239 7:868409-868431 GCTGCAGGCTGCACCGTGGCCGG + Intronic
1022980567 7:35601475-35601497 TCTTCTGACTGAAACTTGGCTGG + Intergenic
1024131947 7:46362064-46362086 TCTTCTTGCTGCCACCTGTCTGG - Intergenic
1027187931 7:75982796-75982818 GCTTCTCGCTCCAGCCAGGCTGG - Intronic
1028296060 7:89133139-89133161 GCCTCCAGCTGCCACCTGGCTGG - Intronic
1029444667 7:100605261-100605283 TCTGCTGGCTGCAAGCTGGAGGG - Intronic
1032573938 7:133032295-133032317 GCATCTGTCTACTACCTGGCAGG + Intronic
1034483736 7:151343234-151343256 GCTGCTGTGTGCAACCTGGGTGG - Intronic
1035374300 7:158397307-158397329 GCTCCTGGCAGCATCCTGGATGG - Intronic
1036259438 8:7228382-7228404 CCATCGGGGTGCAACCTGGCCGG - Intergenic
1036288086 8:7462363-7462385 GCATGGGGCTGCAACCTGGCAGG + Intronic
1036307188 8:7611142-7611164 CCATCGGGGTGCAACCTGGCTGG + Intergenic
1036310431 8:7680834-7680856 CCATCGGGGTGCAACCTGGCCGG - Intergenic
1036311480 8:7686952-7686974 CCATCGGGGTGCAACCTGGCCGG - Intergenic
1036333389 8:7849165-7849187 GCATGGGGCTGCAACCTGGCAGG - Intronic
1036358030 8:8059129-8059151 CCATCGGGGTGCAACCTGGCTGG + Intergenic
1036359106 8:8065271-8065293 CCATCGGGGTGCAACCTGGCTGG + Intergenic
1036891852 8:12601681-12601703 CCATCGGGGTGCAACCTGGCTGG - Intergenic
1036892917 8:12607817-12607839 CCATCGGGGTGCAACCTGGCTGG - Intergenic
1037808203 8:22069967-22069989 GCTTCCGGCTGCATGCTGGGAGG + Intronic
1038671130 8:29584144-29584166 GGTTCGGGCTCCAGCCTGGCCGG - Intergenic
1038687072 8:29728520-29728542 GCCTCTGTCTGCAGCCTGACTGG - Intergenic
1045063979 8:98429150-98429172 GCCTCTGCCTGCATCTTGGCAGG + Exonic
1045507837 8:102791119-102791141 GCCTGTGGCAGCACCCTGGCAGG + Intergenic
1048186973 8:132250326-132250348 GCCTCTGGACTCAACCTGGCTGG + Intronic
1049207909 8:141371957-141371979 GCTGCCAGCTGTAACCTGGCTGG - Intergenic
1049683951 8:143931805-143931827 GCTGCTGCCTGCAGCCTGACCGG - Intronic
1057806215 9:98221568-98221590 GCTTCTGGCTGGGAAGTGGCAGG + Intronic
1057998246 9:99840179-99840201 GGATCTGGCTGGAGCCTGGCAGG + Intronic
1058539318 9:105995176-105995198 GCTTCTGGCAGCTGGCTGGCTGG - Intergenic
1059326221 9:113505407-113505429 GCTTCTGGCAGTGACCGGGCAGG + Intronic
1060149482 9:121279177-121279199 GCATCTGGCTGGAGCCTGGTGGG + Intronic
1061662809 9:132141516-132141538 CATTCTGCCTGCTACCTGGCTGG - Intergenic
1061948593 9:133922493-133922515 GCTTCTGGCTGCCAACCCGCAGG + Intronic
1062046606 9:134427347-134427369 GCTGCCTGCTGCCACCTGGCAGG + Intronic
1186692836 X:11997530-11997552 GTTTCTGGCTGCAACTTGGTGGG + Intergenic
1187719566 X:22137152-22137174 GATTCTGACTGAGACCTGGCAGG + Intronic
1189351489 X:40279039-40279061 GAGTCTGGCTGCAGCCTGTCTGG + Intergenic
1192550261 X:72047917-72047939 GCTTCTGGCCACTGCCTGGCTGG - Intergenic
1197918732 X:131565153-131565175 GCTTCTGGATACATCCTGGCAGG + Intergenic