ID: 1069747366

View in Genome Browser
Species Human (GRCh38)
Location 10:70724349-70724371
Sequence GGCTACGAGGCACACCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069747366_1069747370 1 Left 1069747366 10:70724349-70724371 CCCTGTGGGTGTGCCTCGTAGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1069747370 10:70724373-70724395 TCCTGTCTCGTGCCCAACCATGG No data
1069747366_1069747372 2 Left 1069747366 10:70724349-70724371 CCCTGTGGGTGTGCCTCGTAGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1069747372 10:70724374-70724396 CCTGTCTCGTGCCCAACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069747366 Original CRISPR GGCTACGAGGCACACCCACA GGG (reversed) Intronic
900475506 1:2874603-2874625 GGCTCACATGCACACCCACAGGG - Intergenic
913532616 1:119743407-119743429 GGCCACCAGGGACAGCCACAGGG - Intronic
914095736 1:144543200-144543222 GCCCACGAGGCACAGGCACACGG - Intergenic
914302784 1:146390769-146390791 GCCCACGAGGCACAGGCACACGG + Intergenic
914939265 1:152007595-152007617 GGATTCCAGGGACACCCACAGGG + Intergenic
916715070 1:167441178-167441200 GGCTCTGAGGCCTACCCACAGGG + Intronic
918085373 1:181240484-181240506 GGATGTGAGGCACATCCACAGGG - Intergenic
922672221 1:227519211-227519233 GGCTTCGAGGCACACTCATGTGG + Intergenic
922802096 1:228369066-228369088 AGGTAAGAGGCACACACACAGGG - Intronic
1067908621 10:50320809-50320831 GGCTCAGAGGCACATCCACAGGG + Intronic
1069747366 10:70724349-70724371 GGCTACGAGGCACACCCACAGGG - Intronic
1076743026 10:132497449-132497471 GGCCAAGTGGCAGACCCACAGGG + Intergenic
1076817919 10:132923582-132923604 GGGTCCGGGGCACCCCCACAAGG - Intronic
1077723936 11:4654633-4654655 AGCTACGAGTCACACTCAAAAGG - Exonic
1083951286 11:65957846-65957868 ACCTTCGAGCCACACCCACATGG - Intronic
1091372120 11:135069650-135069672 TGGGATGAGGCACACCCACATGG - Intergenic
1091599157 12:1907684-1907706 GCCCACCAGGCACACCCACCAGG - Intronic
1091599185 12:1907787-1907809 GCCCACCAGGCACACCCACCAGG - Intronic
1094496020 12:30989918-30989940 GGCTTGGAGGCCCAGCCACATGG - Intronic
1095097142 12:38154863-38154885 GGCTGCGTGTCGCACCCACAGGG + Intergenic
1120171028 14:81247482-81247504 GGCTCAGGGGCACGCCCACAAGG + Intergenic
1121713602 14:96057045-96057067 GGCTCACAGGCACACCTACAGGG + Intronic
1122404247 14:101490431-101490453 GTCTACGAGGCACACACACGTGG + Intergenic
1128369738 15:67031924-67031946 GCCTTCGAGGCACATCCACTTGG + Intergenic
1132592215 16:731023-731045 GTCTACATGGCACACCCACCAGG + Intronic
1138635054 16:58331587-58331609 GGCTGAGAGCCACACTCACAGGG - Intronic
1142807974 17:2381424-2381446 GGGTGAGAGCCACACCCACAGGG - Intergenic
1146932558 17:36787941-36787963 GACCACGGGGCACACCCAGATGG - Intergenic
1147382601 17:40064119-40064141 AGCTACTGGACACACCCACATGG + Intronic
1148846438 17:50532753-50532775 GGCTAGGAGGCAAACGCACGCGG + Exonic
1155044178 18:22089064-22089086 GCCTGCCAGGCACCCCCACACGG - Intronic
1155066405 18:22272906-22272928 AGCTATGAGACACAGCCACAAGG - Intergenic
1160106832 18:75986288-75986310 GTCTTCAAGCCACACCCACAAGG + Intergenic
1162053779 19:8050841-8050863 GGCTAGAAGCCACACCCACCAGG + Intronic
1162913986 19:13864894-13864916 GGCTGCGAGACACACACCCAAGG - Intronic
927476855 2:23420254-23420276 GGCTTCGAGGGACGGCCACAAGG - Intronic
927733883 2:25500900-25500922 GGCCATGAGCCACACACACAAGG + Intronic
932618182 2:73249333-73249355 TGCTACTGGGCACACACACATGG - Intronic
936952102 2:117988166-117988188 TGCTAAAAGGCACACACACAGGG + Intronic
946331283 2:219010492-219010514 GGCTCTGAGGCTCTCCCACAAGG + Intronic
1170956050 20:20980372-20980394 GGCAAGAAGGCACACACACATGG + Intergenic
1172024930 20:31942063-31942085 GCCTACGATGCACATCCTCAGGG - Intronic
1175870236 20:62205894-62205916 GGCTTCCTGGCACAGCCACAGGG - Intergenic
1175986939 20:62768680-62768702 GGCTAGGAGGCCCACCCAGGAGG + Intergenic
1177212347 21:18086972-18086994 AGCTACCAGGAACACCCACATGG - Intronic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1181151726 22:20888634-20888656 GGCTGCGAGGCTGACCGACAGGG + Exonic
1184517514 22:44971719-44971741 CTCTACCAGGCACACCCACGAGG - Intronic
1185360241 22:50402381-50402403 GGACACCAGGCACAGCCACAGGG - Intronic
949485258 3:4531876-4531898 GGCTGAGAGCCAAACCCACAGGG - Intronic
955143139 3:56289495-56289517 GGCTCTGAGGCCCACACACAGGG - Intronic
958195933 3:90243054-90243076 TGCTAAGAGAAACACCCACATGG - Intergenic
981508059 4:145525053-145525075 GGCCACCGGGCACTCCCACATGG - Intronic
985521717 5:376911-376933 GCCTACGAGGCTCACACCCAAGG - Intronic
1002542668 5:179916614-179916636 GGCTGCGAGGCACATTCACGAGG - Intronic
1008906876 6:56687516-56687538 GACTAAGAGGTACACACACATGG + Intronic
1012335120 6:98045764-98045786 TGCTTCTAGGCACACACACATGG + Intergenic
1017880085 6:158556559-158556581 GGCTACAAGGATCACTCACAAGG + Intronic
1019569703 7:1705141-1705163 GGCTGCAGGTCACACCCACAGGG + Intronic
1026459606 7:70602068-70602090 GACTACCAGGCACATCCTCAGGG + Intronic
1029483427 7:100826036-100826058 GGCTATGAGGGACTCCCAAAGGG - Intronic
1035047632 7:155979720-155979742 GGCCACCAGGCACACTCACCAGG + Intergenic
1039162646 8:34639668-34639690 GGCTTACAGGCACCCCCACATGG + Intergenic
1040964025 8:53065751-53065773 GGCTGTGCGGCCCACCCACAGGG - Intergenic
1041296472 8:56362370-56362392 AGCTATGAGGAACACCAACATGG - Intergenic
1041470982 8:58208818-58208840 GGCTCCCAGGCTCTCCCACAGGG - Intergenic
1042709840 8:71705374-71705396 AGCTACCAGGCACCCCAACAAGG - Intergenic
1043642108 8:82467256-82467278 GGCTACTATGCACACACTCAAGG + Intergenic
1057144599 9:92749427-92749449 GGCTGAGAGGCACCCACACAGGG + Intronic
1060151105 9:121288941-121288963 TGCTACGTGGCACAGTCACAGGG + Intronic
1062034646 9:134377527-134377549 GGCTGCAGGGCACACACACACGG - Intronic
1196026062 X:111042515-111042537 GGCTATGTTGCACACCCACAAGG + Intronic