ID: 1069749322

View in Genome Browser
Species Human (GRCh38)
Location 10:70735458-70735480
Sequence GAGTGAACACCTGTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069749315_1069749322 -1 Left 1069749315 10:70735436-70735458 CCAGCCACCATGCAGGGATGCAG 0: 1
1: 0
2: 3
3: 55
4: 470
Right 1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 231
1069749310_1069749322 26 Left 1069749310 10:70735409-70735431 CCTGGTGATGGGCCCACAGACAC 0: 1
1: 0
2: 1
3: 19
4: 181
Right 1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 231
1069749311_1069749322 14 Left 1069749311 10:70735421-70735443 CCCACAGACACAGTGCCAGCCAC 0: 1
1: 0
2: 2
3: 23
4: 266
Right 1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 231
1069749312_1069749322 13 Left 1069749312 10:70735422-70735444 CCACAGACACAGTGCCAGCCACC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 231
1069749317_1069749322 -8 Left 1069749317 10:70735443-70735465 CCATGCAGGGATGCAGAGTGAAC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 231
1069749316_1069749322 -5 Left 1069749316 10:70735440-70735462 CCACCATGCAGGGATGCAGAGTG 0: 1
1: 0
2: 1
3: 32
4: 259
Right 1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069749322 Original CRISPR GAGTGAACACCTGTGGGGGC AGG Intronic
900591669 1:3463001-3463023 GGGTGGACACCCGCGGGGGCAGG + Intronic
901061716 1:6474750-6474772 GTGTGAGCACCTCTGCGGGCAGG - Intronic
901923303 1:12550880-12550902 GGGGGAAAACCTCTGGGGGCAGG - Intergenic
902407966 1:16196634-16196656 ATGTGAACACCTGTGGGGCTGGG - Intergenic
903212031 1:21823936-21823958 GACTGAACTCCGCTGGGGGCAGG - Exonic
903269644 1:22179272-22179294 AAGTGAAAACCAGAGGGGGCGGG + Intergenic
903590326 1:24450763-24450785 CAGTGAACACCTTTGTCGGCAGG - Intronic
904342903 1:29849323-29849345 GAGGGAACACCTGGGGGGCATGG + Intergenic
905124819 1:35708789-35708811 GTGTGAACGGGTGTGGGGGCTGG + Intergenic
906118063 1:43368307-43368329 GACTGCACATCTGTGGCGGCAGG + Intergenic
906294601 1:44641758-44641780 TTCTGAACACCTGTGGGGGTAGG + Intronic
906298247 1:44662316-44662338 GAGCCAGCACCTGTGGAGGCCGG - Intronic
906711160 1:47930875-47930897 GAATCAACAGCTGTGGGGTCGGG - Intronic
907918681 1:58893659-58893681 GCGTGAGCCCCTGTGGAGGCTGG - Intergenic
910986395 1:93008754-93008776 GACTACACACCGGTGGGGGCAGG + Intergenic
912472507 1:109915249-109915271 GATTGAACACCTGTAGGGGTTGG - Intronic
913550356 1:119911203-119911225 GAATGATCACCTGTGCAGGCCGG - Intergenic
913566919 1:120081490-120081512 GAAGCAACACCTGTGGGGACTGG + Intergenic
913631210 1:120712059-120712081 GAAGCAACACCTGTGGGGACTGG - Intergenic
913942207 1:125119363-125119385 GGGTAAAAACCTGTGGCGGCGGG - Intergenic
914287673 1:146242197-146242219 GAAGCAACACCTGTGGGGACTGG + Intergenic
914548704 1:148692940-148692962 GAAGCAACACCTGTGGGGACTGG + Intergenic
914617976 1:149378771-149378793 GAAGCAACACCTGTGGGGACTGG - Intergenic
914807974 1:151005596-151005618 GAGTGGACACCTGAGGGAGTGGG + Intronic
915490896 1:156249585-156249607 GACTGAAGACCTGAAGGGGCTGG - Exonic
916424858 1:164670558-164670580 GACTGAAGGCCTGTGGGGTCAGG + Intronic
916732689 1:167580650-167580672 GAATCAACACCTGTCGGGGGTGG + Intergenic
919293825 1:195668670-195668692 GAGTGAGCACATGTGGGGTTTGG + Intergenic
922766874 1:228160585-228160607 GAGTGGACACCTGTTGGGGTTGG - Intergenic
922798514 1:228353298-228353320 GAGGCAGCACCTGTGTGGGCTGG + Intronic
923018113 1:230142441-230142463 GAGTGATCAGCTGGCGGGGCTGG - Intronic
924477577 1:244395308-244395330 GAGAGCACATCTGTGGGGGCTGG + Intergenic
1063716206 10:8529534-8529556 GAGTGAACAACTTTGGTGGATGG - Intergenic
1066176490 10:32912717-32912739 TAGACAACACCTCTGGGGGCAGG + Intronic
1067530298 10:47066256-47066278 CAGGGGACACCTGTGGAGGCTGG - Intergenic
1067719301 10:48715077-48715099 GAGTGAACACCTGTGTGGAGAGG + Intronic
1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG + Intronic
1070282782 10:75062004-75062026 GAATGACCACCCGTGGGGGAGGG - Intergenic
1071164638 10:82791145-82791167 AAGTAAACCCATGTGGGGGCAGG - Intronic
1071231885 10:83597600-83597622 GAGTGAAAAGCTGTCGGGTCTGG - Intergenic
1075645208 10:124092447-124092469 GAGGGGACAGCAGTGGGGGCGGG + Intronic
1075860809 10:125675053-125675075 GACTGAACCCCTGTGGGGAGGGG - Intronic
1076238897 10:128887363-128887385 GAGTGTACAACTGTGGGTACAGG - Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1076696414 10:132249450-132249472 GAGTGGACACCTGTGGGCCTGGG + Intronic
1077340128 11:2022572-2022594 GTGTAAACAGCTGTGGCGGCTGG + Intergenic
1080586427 11:33686883-33686905 GAGTTAACTGTTGTGGGGGCAGG - Intergenic
1083367144 11:62148279-62148301 GTGTGCACACCTGAGGGTGCAGG - Intronic
1083427103 11:62593858-62593880 GACTGAGCACCTGTGGGGAAGGG - Exonic
1084980265 11:72825125-72825147 GTGAGAACACCTGGTGGGGCCGG + Intronic
1087585909 11:100121485-100121507 GATTGAAAAACAGTGGGGGCAGG + Intronic
1088611415 11:111581022-111581044 GAATTAACACCTATGGGGGAGGG + Intergenic
1202823113 11_KI270721v1_random:77761-77783 GTGTAAACAGCTGTGGCGGCTGG + Intergenic
1091414864 12:273160-273182 AAGTGAACACCAGGGGAGGCAGG - Intergenic
1091634924 12:2189637-2189659 GAGTGGAAACCTGTAGGGGCAGG + Intronic
1096035593 12:48466998-48467020 GAGTGAACATCTGTTGGGGAGGG - Intergenic
1096220682 12:49826843-49826865 GAGTGAGGACCTGGAGGGGCAGG - Intronic
1096426203 12:51505567-51505589 GAGTGCACAGTTGTGGGAGCAGG + Intronic
1100453950 12:94733743-94733765 CACTGAGCATCTGTGGGGGCAGG - Intergenic
1101512623 12:105406731-105406753 GCATGGACACCTGTGGTGGCAGG + Intergenic
1102535669 12:113578874-113578896 GAGAGACCACCTGTCTGGGCTGG - Intergenic
1107016047 13:35708378-35708400 GGGTCAACACCTGTCGGGGAGGG - Intergenic
1107068450 13:36243169-36243191 GGATCAACACCTGTGGGGGAAGG - Intronic
1108108565 13:47041637-47041659 GGGTGAAGAGGTGTGGGGGCAGG - Intergenic
1111104014 13:83622352-83622374 GAGTGAACACTTTTGGGCACTGG - Intergenic
1113542494 13:111119878-111119900 GAGTGATCACATGTGGTGGTAGG + Intronic
1114751793 14:25212446-25212468 GAGTGAAAATCTGTGGGAGTGGG + Intergenic
1116479914 14:45385144-45385166 GAGTGAACACTGGTGTAGGCAGG - Intergenic
1120901355 14:89578564-89578586 GAGTGAACACATTTGGGGTGGGG - Intronic
1121924639 14:97916449-97916471 GAATGGCCACCTTTGGGGGCTGG + Intergenic
1122214495 14:100193938-100193960 GAGTCAGCGCCTGCGGGGGCGGG + Intergenic
1124933524 15:34147606-34147628 GTGTGAGCAACTGTGGGGGTTGG + Intronic
1126143584 15:45456493-45456515 GTGTGAAGCCCTGTGAGGGCTGG + Intergenic
1126738010 15:51751463-51751485 GAGAGGACACCTGTCGGGGAAGG + Intronic
1127262213 15:57334743-57334765 GAGTGAGCACCCGCGAGGGCAGG - Intergenic
1128074908 15:64819977-64819999 ATCTGAACACCTGTTGGGGCTGG + Exonic
1129330959 15:74826907-74826929 GACTGAGCAGCTGTGGGGGTGGG - Intronic
1131746999 15:95459465-95459487 ATGTGAACTCCTTTGGGGGCAGG + Intergenic
1132349843 15:101132915-101132937 GAGTGGAGGCCTGTGGGGGAAGG - Intergenic
1132659090 16:1053644-1053666 GAGTGGACAGAGGTGGGGGCTGG - Intergenic
1133241397 16:4416372-4416394 GAGGGCACCCCTGTGGGGTCCGG + Intronic
1133406659 16:5529904-5529926 GAGAGAACACCAGTGAAGGCTGG + Intergenic
1133678962 16:8102364-8102386 GAGTGAAAACATGTGGTGTCTGG - Intergenic
1136696337 16:32084742-32084764 GGGTAAAAACCTGTGGCGGCGGG + Intergenic
1136796832 16:33027994-33028016 GGGTAAAAACCTGTGGCGGCGGG + Intergenic
1139851061 16:69951803-69951825 GAGGGAACAGCGGTGCGGGCTGG - Intronic
1139880041 16:70174715-70174737 GAGGGAACAGCGGTGCGGGCTGG - Intronic
1140372470 16:74420802-74420824 GAGGGAACAGCGGTGCGGGCTGG + Intronic
1141282947 16:82645242-82645264 GAATGAAAGCCTCTGGGGGCAGG + Intronic
1141461056 16:84179153-84179175 GAGTCAACTCCTGGGAGGGCGGG + Exonic
1203067729 16_KI270728v1_random:1033975-1033997 GAGTGAGCACATGTGAGGGTGGG + Intergenic
1144725512 17:17499977-17499999 GAGTGAGCACCTGTGCAAGCAGG + Intergenic
1146300620 17:31686252-31686274 GACTGAGCACCGCTGGGGGCAGG + Intergenic
1146368783 17:32250956-32250978 GAGTGAAGACCTTTAGGGACAGG + Intronic
1147427366 17:40352249-40352271 GAGGGCAGGCCTGTGGGGGCTGG + Intronic
1147820428 17:43238287-43238309 TAGTGAAAACCTGTTCGGGCTGG - Intergenic
1147822540 17:43250179-43250201 TAGTGAAAACCTGTTCGGGCTGG - Intergenic
1147825057 17:43264974-43264996 TAGTGAAAACCTGTTCGGGCTGG - Intergenic
1147828177 17:43282494-43282516 TAGTGAAAACCTGTTCGGGCTGG - Intergenic
1147829287 17:43288658-43288680 TAGTGAAAACCTGTTCGGGCTGG - Intergenic
1147830377 17:43294793-43294815 TAGTGAAAACCTGTTCGGGCTGG - Intergenic
1148615825 17:48998642-48998664 GAGCGGTCACCTGTCGGGGCTGG - Intronic
1151396578 17:73826960-73826982 GAGTGAACAGGTCTGGGGGCTGG - Intergenic
1151641184 17:75395542-75395564 GAGTGATCGCCTGTGGGTGTTGG - Intronic
1151671272 17:75573001-75573023 GCGTGAACACCTGGGGGCGTGGG - Exonic
1151816876 17:76475504-76475526 GAGTGAACAGCTGGTGGGGAGGG - Intronic
1151885983 17:76923660-76923682 GTGTGTACACCTGGGGGTGCTGG - Intronic
1152258941 17:79256127-79256149 GGGTGCACACCTGGCGGGGCTGG - Intronic
1152551070 17:81030559-81030581 GAGTGACCATCTGTGTTGGCTGG + Intergenic
1152866609 17:82727460-82727482 AAGTGAACCCCTGTGGGTGCGGG + Exonic
1153558877 18:6349793-6349815 GAGTAATCACCTGTGGTGGGAGG + Intronic
1160799984 19:963272-963294 CAGTGAAGACCAGTGAGGGCAGG - Intronic
1164370576 19:27640217-27640239 CAGTGATCATCTGTGGGGCCAGG + Intergenic
1164417698 19:28060187-28060209 CAGTGAACACCTCAAGGGGCTGG - Intergenic
1164912943 19:32027055-32027077 GAGTTAGCACCTGGGGTGGCAGG - Intergenic
1165367941 19:35381115-35381137 CAGAGAACAGCTGTAGGGGCAGG - Intergenic
1165606465 19:37109229-37109251 CAGTGATCATCTGTGGGGCCAGG + Intronic
1165819653 19:38666345-38666367 GAGTGACAACCGATGGGGGCTGG + Intronic
1165895742 19:39139792-39139814 GACTGTACAGCTGTGGGGTCTGG + Intronic
1166567012 19:43771497-43771519 AAGTGCATACCTGTGGGGCCAGG - Intronic
1166588113 19:43969173-43969195 GAGGGAGCTCCTGTGGGGGAAGG + Intronic
926092077 2:10057801-10057823 GAGGGGACTCCTGTGTGGGCGGG - Exonic
927318642 2:21716932-21716954 GAGTGAAGAACTGTGGAGGGAGG + Intergenic
927425637 2:22978569-22978591 GAGTGAAGACATGAGGGAGCTGG + Intergenic
927708309 2:25310553-25310575 GAGTGCAGAGCTGTGGGTGCTGG - Intronic
931037006 2:58254929-58254951 GAGTCAACACCTGTGGGAAAAGG - Intergenic
932627535 2:73309529-73309551 TAGTGAATAACTGTGGGGCCAGG - Intergenic
936026066 2:109031912-109031934 GAGTGAACGGATGTGGGGGGAGG - Intergenic
937203913 2:120223678-120223700 GAGCGCAGACCTGTGGGGGCCGG + Intergenic
946505881 2:220300163-220300185 GAGTGACCACCTGTGGGTTGGGG + Intergenic
946849879 2:223895479-223895501 GCGTGACCACTTGTGGGGGTGGG - Intronic
948589884 2:239042273-239042295 GAGTGCTCACGTGTGGGGCCTGG - Intergenic
948797699 2:240413139-240413161 GAATGGACACCAGTGGGGACTGG + Intergenic
948801441 2:240435347-240435369 GTGGCACCACCTGTGGGGGCGGG - Intergenic
1169022258 20:2339217-2339239 GTGTGAGCAGCTGTGGGGCCTGG + Intronic
1170223440 20:13965091-13965113 GAGTGGACAGCTGTGGGTGCAGG + Intronic
1171484447 20:25477046-25477068 GAGTGGAGAGCTGTCGGGGCTGG - Exonic
1172202352 20:33135438-33135460 GAGGGGTCACCTCTGGGGGCAGG - Intergenic
1172879266 20:38188124-38188146 CAGTGATTACCTGTGGGGGATGG - Intergenic
1173313745 20:41924867-41924889 GAGTGATCATCTGTGGAGGATGG - Intergenic
1173607010 20:44338605-44338627 CATTAAACACCTGTTGGGGCAGG - Intronic
1174897124 20:54461766-54461788 GAGAAAACACCTGTGAAGGCAGG + Intergenic
1175683203 20:61006387-61006409 GAGGGACCAGCTGTGGGGGGAGG + Intergenic
1175955140 20:62605215-62605237 GAGCATACACCTGTGGGAGCAGG + Intergenic
1178614166 21:34116020-34116042 GAGTGAAACCCTGTCGGGGTTGG - Intronic
1179198035 21:39183797-39183819 GAATGAAAGCCTTTGGGGGCCGG - Exonic
1180412228 22:12624667-12624689 GAGTGACTACCTTTGGGAGCTGG - Intergenic
1180695144 22:17747157-17747179 GAGTGGACAGCTGTGTGGACAGG + Intronic
1181002669 22:19995146-19995168 GAGTGAACAAGTGTGTGGACAGG + Intronic
1181363258 22:22354897-22354919 GAGAGGACACCTGTGGGACCAGG - Intergenic
1181366124 22:22378351-22378373 GAGGGGACACCTGTGGGACCAGG - Intergenic
1182146682 22:28001045-28001067 GGCTGAGCACCTGAGGGGGCTGG - Intronic
1183324759 22:37185193-37185215 GAGTGCCCTCCTGTGGGGCCTGG - Intronic
1183327174 22:37200606-37200628 GAGTGCACACCTGTGTGTGGAGG - Intergenic
1183732568 22:39627052-39627074 GAGTGAAAAGCTGTAGGGTCAGG - Intronic
1183978302 22:41525731-41525753 GGGTGCCCAACTGTGGGGGCAGG - Intronic
1184168238 22:42743296-42743318 GATTGAAAAGCTGTGAGGGCTGG + Intergenic
1184219765 22:43092220-43092242 CAGTGAACAAATCTGGGGGCAGG + Intergenic
1184739916 22:46421818-46421840 GACAGAACACCTGCTGGGGCTGG + Intronic
1184921479 22:47608618-47608640 GAGAGAACACCAGGAGGGGCAGG + Intergenic
1185142166 22:49108590-49108612 GAGAGAAGGACTGTGGGGGCCGG - Intergenic
1185283004 22:49983656-49983678 GAGGGAGCAGCTGCGGGGGCGGG - Intergenic
949856627 3:8467669-8467691 GATTAAACACCTGTTGGGGCTGG - Intergenic
953404425 3:42653615-42653637 GCATGGACACCCGTGGGGGCAGG - Intergenic
953496746 3:43393987-43394009 GAATGAACACCCCTGGGGGTGGG + Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
954990160 3:54833727-54833749 GAGTCCAGACCTGTGGGGACTGG + Intronic
957210155 3:77248577-77248599 GGGTGAGCACCTTTGGGTGCTGG - Intronic
958175967 3:89996515-89996537 GAGAGTCCACCTCTGGGGGCAGG + Intergenic
960280871 3:115780312-115780334 GAAAGAACAGCAGTGGGGGCCGG + Intergenic
960433717 3:117600448-117600470 GTGTGAACACCTGTTGGGCTGGG - Intergenic
960974568 3:123161779-123161801 GAGTGACCCCCTGGAGGGGCTGG + Intronic
961518928 3:127455873-127455895 CAGTGAGCACCTGTAGAGGCTGG - Intergenic
962084257 3:132173871-132173893 GAGGGAAGACCTGTGGGGGTAGG - Intronic
963006844 3:140734482-140734504 CATTGAGCACCTGGGGGGGCAGG - Intergenic
967233936 3:187366828-187366850 GTGTGAGCATCTGTGGGGGCAGG + Intergenic
967491042 3:190091030-190091052 GACTGAATACCTGTGTTGGCAGG - Intronic
969479386 4:7439889-7439911 GGGTGTGCACCTGTGGGGGCAGG + Intronic
969847281 4:9929449-9929471 GAGTTAATACCCCTGGGGGCAGG - Intronic
970130818 4:12868457-12868479 GAGTGATTACCTGTGTGGGAAGG - Intergenic
970567588 4:17347597-17347619 AAATGAACACCTGTGGGAGCAGG - Intergenic
973607638 4:52603393-52603415 GAGTGAACGCCTGGGAAGGCTGG + Intronic
974867903 4:67603183-67603205 GAGTGAACATCAGTGGTAGCCGG - Intronic
975306613 4:72856671-72856693 GAGTGAAAACCTGTGGTGTTTGG - Intergenic
980158550 4:129133994-129134016 AAGAGACCACCTCTGGGGGCAGG - Intergenic
980697741 4:136381711-136381733 GAGTGATTACCTGTGGAGGATGG - Intergenic
981701958 4:147617270-147617292 GATTGGTCAGCTGTGGGGGCGGG - Intergenic
981910774 4:149979394-149979416 GAGTGAAAACATGTGGTGGTTGG - Intergenic
984360249 4:178720864-178720886 GGATGTACACCGGTGGGGGCAGG - Intergenic
984920289 4:184758055-184758077 GAGTGAACTCCTGGGGGAGGGGG - Intronic
985859580 5:2460388-2460410 GTGTGAGCACCTGTTGGGGCCGG + Intergenic
987331277 5:16859824-16859846 GAGTGAACAGCTCTGGGGGTGGG - Intronic
987903917 5:24051005-24051027 GAGTGAACATCAGTGTGGCCAGG + Intronic
992626379 5:78639123-78639145 GTGTGTACACCTGTGTGGACAGG - Intronic
992894272 5:81233209-81233231 AAGGGTACAGCTGTGGGGGCCGG + Intergenic
996389751 5:122947045-122947067 GAGTGAACATGGCTGGGGGCAGG + Intronic
997205156 5:132043828-132043850 CAGAGAACACCAGTGGGGGTGGG + Intergenic
998856425 5:146399199-146399221 GGGTGAGCACTTATGGGGGCTGG - Intergenic
1001366835 5:171149952-171149974 TAGTGAACAGATGTGGGGGTAGG + Intronic
1005051818 6:21691332-21691354 GAGTTAAGACCTTTGTGGGCTGG - Intergenic
1006427328 6:33974644-33974666 GAGTGAAGAGCTGCGGGGGGTGG - Intergenic
1007230344 6:40343763-40343785 GGGTGAACTGCTCTGGGGGCTGG + Intergenic
1007766596 6:44164255-44164277 GAGTGAAAGCCTGTGAGGGCAGG - Intronic
1011609356 6:89135040-89135062 TAGTGAACACCTGCAGGAGCTGG + Intergenic
1011624053 6:89269225-89269247 TAGTGAAGTCCTGTGGGAGCCGG + Exonic
1012343431 6:98156772-98156794 GACAGAACACCTGTGGGGAGGGG - Intergenic
1017522226 6:155212814-155212836 CAGTGAGCACGTGTGGGGTCTGG + Intronic
1019347825 7:539281-539303 GAGGCACCACCTCTGGGGGCCGG + Intergenic
1019822399 7:3254952-3254974 GAGTGAATTCCTTAGGGGGCAGG + Intergenic
1022913860 7:34926903-34926925 GAGTGAAGACCTGAGGAGCCTGG + Intergenic
1024391395 7:48816843-48816865 GAGTGCAGTCCTGAGGGGGCAGG + Intergenic
1024765424 7:52652333-52652355 GAGGGAAAACCTGTTTGGGCAGG - Intergenic
1025561361 7:62377534-62377556 CAGTAAAAACCTGTGGCGGCGGG - Intergenic
1026805254 7:73425329-73425351 GAGAGAGAAGCTGTGGGGGCTGG - Intergenic
1029012058 7:97272549-97272571 GAGAGAAGAGCTGTGGGGCCAGG + Intergenic
1032019632 7:128400173-128400195 GCGTCATCACCTGTGGGGCCAGG + Exonic
1035311895 7:157974826-157974848 GGGTGAAGAGCTGTGCGGGCGGG + Intronic
1035397509 7:158544879-158544901 GTGTGAGCACCAGTGTGGGCAGG - Intronic
1035949985 8:4009726-4009748 GAGTGAGCGCCTGTGGAGGTAGG - Intronic
1037287141 8:17313354-17313376 GAGTGATTTCCTGTGGGGTCTGG - Exonic
1039880599 8:41623138-41623160 GAGGGAAGTCCTGTGCGGGCCGG + Exonic
1041317465 8:56579418-56579440 GAGTGAAGCCCTTTGGAGGCAGG - Intergenic
1044849039 8:96409797-96409819 GAGTGAACATTTGTGTGGACAGG - Intergenic
1045264453 8:100607314-100607336 GTGTGAACACCTGGGGCAGCTGG + Intronic
1045782764 8:105886876-105886898 GAGCGAACAAATGTGGGGTCCGG - Intergenic
1049268304 8:141681273-141681295 GAGGCAACACCTGATGGGGCAGG - Intergenic
1049443122 8:142618193-142618215 GAGTGGTCACATGTGGGGGGCGG - Intergenic
1049580733 8:143409397-143409419 CAGAGTACACCGGTGGGGGCAGG + Intergenic
1049820238 8:144629030-144629052 GAGCCAACACCTTTGGGGGAGGG - Intergenic
1049965118 9:772606-772628 GAGTGAGAACATGTGGTGGCTGG - Intergenic
1058916247 9:109568646-109568668 GTGTGCACACCGGTGGGGGTAGG - Intergenic
1058941695 9:109819109-109819131 GAGTTTTCACCTGTGGGGGAAGG - Intronic
1060186820 9:121568656-121568678 CAGTGAACAGCTCTGGAGGCAGG - Intronic
1060309403 9:122445850-122445872 GAGTGAGGACCTGTGTGGTCTGG + Intergenic
1061587776 9:131579672-131579694 CAGTGAGCACCTGTGTGGGCTGG + Intronic
1062426100 9:136506964-136506986 CAGTGCACACCTGCGGGGCCAGG + Exonic
1202803297 9_KI270720v1_random:22371-22393 GAGTGACTACCTTTGGGAGCTGG + Intergenic
1189094229 X:38121145-38121167 GAGTGAATTCCTGTGAGAGCTGG - Intronic
1189340495 X:40201196-40201218 CAGTGAGTACCGGTGGGGGCAGG - Intergenic
1190031592 X:46978386-46978408 GAGTGAATAATTGTGGGGGAGGG + Intronic
1190321840 X:49184395-49184417 GGGAGAACACTTCTGGGGGCGGG + Intronic
1191601992 X:63018422-63018444 TAGACAACACCTCTGGGGGCAGG + Intergenic
1192277503 X:69648592-69648614 GACTGAACTCCTGTGGGGAGGGG - Intronic
1193654567 X:84183898-84183920 GAATGTAAACCTGTGGGGGTAGG + Intronic
1194125249 X:90008549-90008571 GTGGGAACACCTGTGAGAGCTGG + Intergenic
1195112121 X:101659108-101659130 GGGTGAACGGCTGTGTGGGCCGG + Exonic
1197340649 X:125263014-125263036 GAGCGAACACTTTTGGGTGCTGG + Intergenic
1198504559 X:137288900-137288922 GAATGGACACCTAAGGGGGCTGG - Intergenic
1199181019 X:144854165-144854187 TAGTCACCACCTCTGGGGGCAGG + Intergenic
1201249989 Y:12047482-12047504 GAGTGAAAACATGTGGTGTCTGG - Intergenic
1201990436 Y:20018295-20018317 GAGTGACCACCTCTGGAGACAGG - Intergenic