ID: 1069750181

View in Genome Browser
Species Human (GRCh38)
Location 10:70740456-70740478
Sequence CACAGCAAGGCTAAGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069750176_1069750181 2 Left 1069750176 10:70740431-70740453 CCCTGTTTTCAAGGGGAAATTAA 0: 1
1: 0
2: 1
3: 28
4: 318
Right 1069750181 10:70740456-70740478 CACAGCAAGGCTAAGTGGCCTGG No data
1069750177_1069750181 1 Left 1069750177 10:70740432-70740454 CCTGTTTTCAAGGGGAAATTAAG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1069750181 10:70740456-70740478 CACAGCAAGGCTAAGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069750181 Original CRISPR CACAGCAAGGCTAAGTGGCC TGG Intronic
No off target data available for this crispr