ID: 1069751933

View in Genome Browser
Species Human (GRCh38)
Location 10:70750416-70750438
Sequence GGCAGAGATGTGCCCCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 161}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069751933_1069751948 22 Left 1069751933 10:70750416-70750438 CCTGACTGGGGCACATCTCTGCC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1069751948 10:70750461-70750483 GGGCCAGGGCTTGTGGAATAGGG No data
1069751933_1069751944 8 Left 1069751933 10:70750416-70750438 CCTGACTGGGGCACATCTCTGCC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1069751944 10:70750447-70750469 CCTTCCTAGAGCATGGGCCAGGG No data
1069751933_1069751936 1 Left 1069751933 10:70750416-70750438 CCTGACTGGGGCACATCTCTGCC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1069751936 10:70750440-70750462 ATACCCCCCTTCCTAGAGCATGG No data
1069751933_1069751947 21 Left 1069751933 10:70750416-70750438 CCTGACTGGGGCACATCTCTGCC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1069751947 10:70750460-70750482 TGGGCCAGGGCTTGTGGAATAGG No data
1069751933_1069751942 7 Left 1069751933 10:70750416-70750438 CCTGACTGGGGCACATCTCTGCC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1069751942 10:70750446-70750468 CCCTTCCTAGAGCATGGGCCAGG No data
1069751933_1069751946 15 Left 1069751933 10:70750416-70750438 CCTGACTGGGGCACATCTCTGCC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1069751946 10:70750454-70750476 AGAGCATGGGCCAGGGCTTGTGG No data
1069751933_1069751937 2 Left 1069751933 10:70750416-70750438 CCTGACTGGGGCACATCTCTGCC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1069751937 10:70750441-70750463 TACCCCCCTTCCTAGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069751933 Original CRISPR GGCAGAGATGTGCCCCAGTC AGG (reversed) Intronic
900575931 1:3382444-3382466 GACACAGCTGTGCCCCAGGCAGG - Intronic
900793235 1:4692904-4692926 GGACGAGGTGTGCCCCATTCTGG + Intronic
902335042 1:15749740-15749762 GCAGGAAATGTGCCCCAGTCTGG + Intergenic
902378302 1:16040710-16040732 GGCAGGGATGGGAGCCAGTCCGG - Intergenic
902551273 1:17221002-17221024 GGCAGATGAGTGCCCCAGGCTGG + Intronic
908674668 1:66590465-66590487 TACAGAGATGTGGCCCAGCCTGG + Intronic
912013539 1:105003438-105003460 GGCATAAATGTGCCCAAGTTTGG + Intergenic
915870819 1:159557854-159557876 GGCATAGATGTGCACCAGGGTGG - Intergenic
916169071 1:161987059-161987081 GCTATAGATGTGCCCCAGGCTGG + Intronic
918195734 1:182219473-182219495 TGCTGGGATGTGTCCCAGTCAGG - Intergenic
922542350 1:226428905-226428927 GGAAGAGTTCTGCCCCAGGCGGG - Intergenic
922909651 1:229204977-229204999 TGCAGAGATAAGCCCCAGCCAGG + Intergenic
923006532 1:230054324-230054346 GGCAGATCTGAGCTCCAGTCAGG - Intergenic
923519721 1:234726083-234726105 GGCAAAAGTGTGCCCCTGTCTGG - Intergenic
1065761711 10:28988883-28988905 GGGAGAGATGTGCAGCAGCCTGG - Intergenic
1069751933 10:70750416-70750438 GGCAGAGATGTGCCCCAGTCAGG - Intronic
1071533007 10:86403061-86403083 GGCAGAGATGAAGCCCAGCCAGG + Intergenic
1076560657 10:131361133-131361155 TGCACAGTGGTGCCCCAGTCAGG - Intergenic
1083683003 11:64359812-64359834 GGCAGAGGTGTGCACCTGGCTGG - Intronic
1084409875 11:69000632-69000654 GGCAGGGCTGTGCCCAAGGCTGG + Intergenic
1085264075 11:75226009-75226031 GGCAGAGGTGAGGCCCAGCCTGG + Intergenic
1086938233 11:92767413-92767435 GGGAGAGATGTGACACTGTCAGG - Intronic
1088375837 11:109140808-109140830 GGCAGGATAGTGCCCCAGTCAGG - Intergenic
1088627150 11:111737602-111737624 GGGAGGGATGTGCCCTGGTCAGG - Intronic
1089137917 11:116264237-116264259 GGGAGAGATGGGCCCCAGCTTGG + Intergenic
1090786781 11:130056313-130056335 TGTAGAGATGTGGCCCAGGCTGG + Intergenic
1090900453 11:131026326-131026348 GACAGACATGTGCCCAATTCTGG - Intergenic
1092003668 12:5051113-5051135 GGCAGGGATGTGCCTCAGGAAGG - Intergenic
1092177984 12:6424000-6424022 GGCAGAGATTTTCCCCAGGGAGG - Intergenic
1097478743 12:60093655-60093677 TGCAGAGGTGTGGCCAAGTCTGG - Intergenic
1101169937 12:102081021-102081043 GGCAGAGCTGGGCCCCATCCAGG - Intronic
1101943820 12:109120779-109120801 GGCAGAGCTGGGCCCCGGGCTGG - Intronic
1102690962 12:114760760-114760782 GGCAGAGATGGCCCCCACCCAGG + Intergenic
1102999548 12:117375014-117375036 GGCATTGATTTGCCCCAGGCTGG - Intronic
1103888662 12:124222005-124222027 GGCAGAGGTATGCCCCAGTTAGG - Intronic
1104724921 12:131070159-131070181 AGCAGAGATGTGGCCCAGAAGGG - Intronic
1104756152 12:131270506-131270528 TGCAGAGATGTGGCCCACTCAGG + Intergenic
1104777627 12:131400519-131400541 TGCAGAGATGTGGCCCACTCAGG - Intergenic
1104802130 12:131561004-131561026 AGCAGAGATGTGGCCCAGAAGGG + Intergenic
1105802696 13:23922654-23922676 GACACAATTGTGCCCCAGTCTGG - Intergenic
1106145600 13:27047210-27047232 GCCAGAGATATGCCCCAGTGTGG + Intergenic
1110829906 13:80019001-80019023 GGTAGAGATGTCCTCCTGTCTGG - Intergenic
1112471471 13:99693552-99693574 GGCAGTGATGTGACCCACTCTGG + Intronic
1113939607 13:114011581-114011603 GGCTGAGATGAGCCCCAGGCAGG - Intronic
1118925297 14:70186379-70186401 AGCAGGGATGTGGCCTAGTCAGG + Intronic
1120392355 14:83924651-83924673 GGCATAAATGTGCACCAGTCAGG + Intergenic
1122534919 14:102455379-102455401 GACAGAGCTGGGCCCCAGGCGGG + Intronic
1122941778 14:104984746-104984768 GGCAGTGATGGGGGCCAGTCTGG + Intergenic
1123982013 15:25613086-25613108 GGCGGAGAAATGCCCCAGCCAGG + Intergenic
1129117613 15:73373937-73373959 GGCAGAGATATGCCCTAGCTTGG + Intergenic
1129688265 15:77698584-77698606 GGCAGGGATGAGCCTCAGTCTGG + Intronic
1130022408 15:80242401-80242423 GGCAGAGATATGGCCCCGTCTGG + Intergenic
1130653001 15:85772902-85772924 GGCACAGAGGTGCCCCAGGCTGG - Intronic
1132219455 15:100094350-100094372 GACAGGGATGTGGCCCAGGCCGG + Intronic
1134491870 16:14701689-14701711 GGTAGAGATGTTGCCCAGGCTGG - Intergenic
1134497251 16:14740807-14740829 GGTAGAGATGTTGCCCAGGCTGG - Intronic
1134572581 16:15303939-15303961 GGCTGAGAAGTGCCACAATCTGG - Intergenic
1134729801 16:16452083-16452105 GGCTGAGAAGTGCCACAATCTGG + Intergenic
1134937630 16:18259813-18259835 GGCTGAGAAGTGCCACAATCTGG - Intergenic
1135108312 16:19670313-19670335 GGCAGAGGTGTCGCCCAGTGGGG + Intronic
1135257257 16:20951007-20951029 TGTAGAGATGTGGCCCAGACTGG + Intronic
1136539422 16:30921079-30921101 GGCAGAGACTTGCCCAAGGCTGG - Intergenic
1138372943 16:56541774-56541796 GGGAGAGAGGTGCCCTAGACTGG - Intergenic
1139354896 16:66361528-66361550 GTCTTTGATGTGCCCCAGTCTGG - Intergenic
1140897258 16:79335639-79335661 GGCAGTGATGTGTCCCAGGCAGG + Intergenic
1141568230 16:84917913-84917935 GGCAGAGATGGGTCCCAGCTTGG + Intronic
1141603244 16:85138767-85138789 AGCAGAGCTGTGACCCAGGCTGG + Intergenic
1142558680 17:796873-796895 GGCAGAGACGGCCTCCAGTCCGG - Intergenic
1143503845 17:7353235-7353257 AGCAGAGAAGTGCACCAGGCGGG - Exonic
1143778894 17:9219125-9219147 GGCAAAGATGTGGCCCAGAGCGG + Intronic
1143781244 17:9230739-9230761 GGGAGAGATGGGCCCCAGAAGGG + Intronic
1144795328 17:17887501-17887523 GTCAGAGCTGTCCCCCAGGCTGG + Intronic
1144965768 17:19076526-19076548 GGCAGAGCTGGGACCCAGGCGGG + Intergenic
1144982199 17:19175656-19175678 GGCAGAGCTGGGACCCAGGCGGG - Intergenic
1144986024 17:19202583-19202605 GGCAGAGCTGGGACCCAGGCGGG + Intergenic
1145122943 17:20277113-20277135 GGGACAGATGTGGCCCATTCAGG + Intronic
1145254702 17:21316229-21316251 GGCAGAGACCTGTCCCAGACTGG - Intergenic
1145321895 17:21771736-21771758 GGCAGAGACCTGTCCCAGACTGG + Intergenic
1146378118 17:32308385-32308407 GGTAGAGATGTTGCCCAGGCTGG - Intronic
1147132202 17:38415958-38415980 GGCAGGGATGAGCACCAGGCTGG + Intergenic
1147759415 17:42787869-42787891 GGCAGAGATGGGACTCAGCCAGG - Exonic
1150122955 17:62618584-62618606 GACATAGATGTCCCCCAGTGGGG + Intergenic
1152622710 17:81373155-81373177 GTCAGAAATGCCCCCCAGTCAGG + Intergenic
1152763170 17:82120184-82120206 TGCAGAGATGTTGCCCAGGCTGG + Intronic
1153991957 18:10408272-10408294 GGCTGAGCTGTGCCCAAGGCTGG + Intergenic
1154982451 18:21514630-21514652 TGTAGAGATGTTGCCCAGTCTGG + Intronic
1155172390 18:23276508-23276530 GGCAGAGTGGGGCCCCAGCCTGG + Intronic
1155342185 18:24823899-24823921 GGAAGAGAGAAGCCCCAGTCTGG - Intergenic
1156488019 18:37478881-37478903 GGCAGGCATGTGCCCTAGCCAGG - Intronic
1156500437 18:37554160-37554182 GGCAGGGATGGGAGCCAGTCCGG + Intronic
1156615202 18:38775022-38775044 GGCGGAGATGCACCCCAGGCAGG + Intergenic
1157451762 18:47794348-47794370 GGCAGGGAGGTCCCCCAGTGAGG + Intergenic
1158557230 18:58485478-58485500 GGCAGAGCAGTCCCCCAGCCAGG - Intronic
1158938433 18:62385249-62385271 GGGAGACATCTGCCCCAGTGCGG - Exonic
1160208920 18:76859927-76859949 CCCACAGATGTGCCCCACTCAGG - Intronic
1160779424 19:871286-871308 GGCCGGGCGGTGCCCCAGTCAGG - Intronic
1162125475 19:8497574-8497596 GGCAGAGGTGTGGCCCAGGTTGG - Intronic
1166891979 19:45999548-45999570 GGCAGTGATTTGCCCGTGTCTGG + Intronic
1167457671 19:49605964-49605986 GGCAGAGATTTGAGTCAGTCAGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
937394939 2:121526378-121526400 GGCTCAGATGTGCCCCAGTAGGG - Intronic
938390856 2:130904210-130904232 AGCAGAGAGATGCACCAGTCAGG - Intronic
943981606 2:194559664-194559686 GGCAGGCTTGTGCCCCAGCCTGG + Intergenic
944522554 2:200586712-200586734 GGCAGAGCTGAACCCAAGTCAGG + Intronic
946224047 2:218252954-218252976 GGCAGAGTTGGGCCCCAGAAAGG + Intronic
947625629 2:231616457-231616479 GGCAGGGCTGGGCCCCAGCCAGG - Intergenic
947874966 2:233461811-233461833 GGCTGAGATGTGGCTCAGGCAGG - Intronic
948401063 2:237685755-237685777 GGAAGAGATGTGAGCCTGTCTGG - Intronic
1169948690 20:11017655-11017677 GTCAGAGATGGGCCCCAGCTGGG - Intergenic
1171429247 20:25070378-25070400 GGCAGAGAAGTGTCCCACGCAGG + Intergenic
1172226071 20:33306058-33306080 GGCAGAGGTATGCACCATTCTGG - Exonic
1172511541 20:35504330-35504352 GGCAGAATTGAGCCGCAGTCTGG + Exonic
1172617722 20:36300217-36300239 GGCTCAGATGTGCCCCAGCCTGG + Intergenic
1173655336 20:44696599-44696621 GGGAGAGCTGTGCATCAGTCAGG - Intergenic
1173809782 20:45948772-45948794 GGCAGCCATGGGCCCCAGCCAGG - Exonic
1174288497 20:49489581-49489603 GGCAAAGGTGTTTCCCAGTCTGG + Intergenic
1174579563 20:51562311-51562333 GGCAGGGAAGTGTCCCAGGCCGG - Intronic
1174601029 20:51724969-51724991 GGCACAGATGTCCCCCAATCTGG - Intronic
1176258142 20:64164334-64164356 GGGTGAGAGGTGTCCCAGTCCGG - Intronic
1176373304 21:6075223-6075245 GGCAGGGCTGTGCACCAGCCAGG - Intergenic
1179394118 21:41022567-41022589 GGCAGAGATGTTGCCTATTCTGG - Intergenic
1179750173 21:43463020-43463042 GGCAGGGCTGTGCACCAGCCAGG + Intergenic
1181635049 22:24170614-24170636 GTCTGGGATGTGCCCCAGGCCGG - Intronic
1183392420 22:37552956-37552978 GGCTGAGATGTGCGGGAGTCAGG - Intergenic
1184060674 22:42079277-42079299 GGCGGAGATGCGCCCAAGGCGGG + Exonic
1184067418 22:42128587-42128609 GGGAGAGGTGTGCCCGGGTCAGG - Intronic
1184070148 22:42142282-42142304 GGGAGAGGTGTGCCCGGGTCAGG - Intergenic
1184071897 22:42151898-42151920 GGGAGAGGTGTGCCCGGGTCAGG - Intergenic
1184473090 22:44706997-44707019 GGCAGAGATGTGTCCCCATCGGG + Intronic
1185409045 22:50673250-50673272 GGCAGAGGGGTTCCCCAGGCTGG + Intergenic
953081908 3:39628833-39628855 GGCAAAGATCAGCCCCACTCTGG + Intergenic
953669028 3:44947142-44947164 GGAGGAGATGAGCCCCAGTAGGG + Intronic
959348829 3:105234123-105234145 GGCAGAGATTTTCCCCTTTCAGG - Intergenic
959530787 3:107431681-107431703 GGCAGGGATGAGCCCTGGTCAGG + Intergenic
967294781 3:187954426-187954448 GGCAGAGAGGTACCACAGTGAGG - Intergenic
968980881 4:3848790-3848812 AGCACAGAGATGCCCCAGTCTGG + Intergenic
976545956 4:86336011-86336033 GTCAGAGATGTCCCCCTGACTGG + Intronic
977530882 4:98199470-98199492 GGCACAGATGTGGCCCAGGCAGG + Intergenic
983290601 4:165799361-165799383 GGCAGAGCTGCCCACCAGTCTGG + Intergenic
985073278 4:186189867-186189889 GGCAGTGAGGTGCCCCTGCCTGG - Intergenic
987571529 5:19668761-19668783 GGCTGAGATGTCATCCAGTCAGG - Intronic
990821440 5:59845005-59845027 GGCTGAGAGCTGCCCCAGGCTGG + Intronic
991649200 5:68834508-68834530 GGCAGATGTGTGTCGCAGTCAGG - Intergenic
992615164 5:78540553-78540575 GGCAGAGAGGGGCCCCACACTGG + Intronic
992771315 5:80050940-80050962 GGCAGAGGTGTGGTCGAGTCGGG + Intronic
997321859 5:132984192-132984214 GGCTGAGATTTTGCCCAGTCTGG - Intergenic
997613531 5:135231324-135231346 GCCAGAGATGTGCTCCAGGAAGG + Intronic
997697191 5:135871244-135871266 GGCTGAGATCGTCCCCAGTCTGG + Intronic
1001506766 5:172285893-172285915 GGCAGAGTAGTGTCGCAGTCAGG + Intergenic
1003498824 6:6687280-6687302 GGCAGAGATGGCTCCCAGCCAGG - Intergenic
1003610290 6:7607477-7607499 GGCATAGATGTGGCACAGTGTGG - Intronic
1004168892 6:13280423-13280445 GGCAGAGATGTGGCGCCTTCCGG + Intronic
1006025127 6:31141880-31141902 GGCCGAGATGTGGCCAAGTTTGG - Intergenic
1006383393 6:33714539-33714561 GGGACAGATGTGGACCAGTCAGG - Intergenic
1017593047 6:155997511-155997533 TTCTGAGATGTCCCCCAGTCCGG - Intergenic
1020608535 7:10367179-10367201 CTCAGAGATGTCTCCCAGTCAGG + Intergenic
1022383262 7:29880590-29880612 GGGAGAAATGGGCCCCAGTCAGG + Intronic
1023300951 7:38770315-38770337 GGCAGAGAGGTGCCACAGCTTGG - Intronic
1023445229 7:40224693-40224715 GGCAAAAATATGCACCAGTCAGG + Intronic
1023833017 7:44051131-44051153 GGCAGTCATGAGCCCCACTCTGG - Intronic
1027052071 7:75026825-75026847 GGCAGAGAAGTGACACCGTCAGG - Intergenic
1028605434 7:92650619-92650641 GGCAGAGCTGTGTTCCATTCTGG + Intronic
1029283034 7:99449001-99449023 GGCAGAGATGTGCTCCCTGCTGG + Intronic
1032784487 7:135189520-135189542 TGCAGACAGGTGCCCCAGACTGG + Intronic
1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG + Intergenic
1035979922 8:4359129-4359151 GGCAGAGTTGTAGCCCAGTTCGG + Intronic
1036441463 8:8785183-8785205 GGCAGAGATGGGGCACACTCAGG - Exonic
1041618167 8:59932577-59932599 GGTAGAGATTTGCCCCAGCAAGG + Intergenic
1045721533 8:105116754-105116776 TGCAGAGATCAGCCCCAGGCAGG + Intronic
1045863287 8:106837187-106837209 GTCAGAGATGGTCACCAGTCTGG + Intergenic
1055522476 9:77095511-77095533 GGCAAAGATGAGCCACAATCAGG + Intergenic
1055677082 9:78674800-78674822 GGCAGACATGCCCCCCAGTCAGG + Intergenic
1060751727 9:126174052-126174074 GGGAGACAGGTGCCCCACTCAGG - Intergenic
1060978544 9:127779398-127779420 GGGAGAGTTGTGGCCCAGTCTGG - Intergenic
1061854409 9:133433683-133433705 GGCCGAGATGTGCAACACTCAGG + Exonic
1061926963 9:133810662-133810684 GGCAGCGCTGTTCCCCAGCCTGG + Intronic
1062254897 9:135616267-135616289 GGAACAGATGGGTCCCAGTCTGG - Intergenic
1191652586 X:63557193-63557215 GACAGAGAAGTGCCCTATTCCGG + Intergenic
1197026871 X:121762059-121762081 GGGAGAGATGTTGCCCAGGCTGG - Intergenic
1200419973 Y:2954651-2954673 GGCACAGCTGTACCCCAGCCTGG + Intronic
1201979288 Y:19890407-19890429 GTCAGAGGTGTTGCCCAGTCAGG + Intergenic