ID: 1069753523

View in Genome Browser
Species Human (GRCh38)
Location 10:70760101-70760123
Sequence GACGCTGCTGCTGCTGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069753521_1069753523 -6 Left 1069753521 10:70760084-70760106 CCAGCAAGCTTCCAGGTGACGCT 0: 1
1: 0
2: 8
3: 65
4: 239
Right 1069753523 10:70760101-70760123 GACGCTGCTGCTGCTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069753523 Original CRISPR GACGCTGCTGCTGCTGCGTG TGG Intronic
No off target data available for this crispr